Individual-group diagnostic, all groups
Listing groups by interaction signature
Group 223 is from HL_69459.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_69459.1
This group is considered to be unstructured ---------------------------
Number of NTs:  2  Signature: cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   4 Score 0.20               CGCGUG (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW
Group  11 is from HL_02811.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_02811.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AGGGAUUUU (   1) MLPS  -8.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-F
Group 150 is from HL_46463.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_46463.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               UUUCGA (   1) MLPS  -3.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-F
Group 202 is from HL_60914.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_60914.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                CUGGG (   1) MLPS  -3.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-F
Group 241 is from HL_76360.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_76360.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-F-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               GUGUCC (   1) MLPS  -4.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-F-F
Group 230 is from HL_70970.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_70970.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                UCUAA (   1) MLPS  -4.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-F-s35
Better:   0 Equal:   0 Score 1.00             GCUUAUGC (   1) MLPS  -6.81 deficit   2.59 prct   0.00 CutScore  72.74;  Ed  0, 0 matches the original group, cWW-F-F-s35
Group 213 is from HL_67205.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_67205.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-F-F-s53
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               CAUUCG (   1) MLPS  -4.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-F-s53
Group 134 is from HL_41285.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_41285.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GAACUC (   1) MLPS  -4.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-s35
Group 217 is from HL_68478.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_68478.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GCUUGC (   1) MLPS  -3.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-s35
Group 176 is from HL_53037.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_53037.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-F-s35-s35-F-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CUAUGGCUAUG (   1) MLPS  -8.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-s35-s35-F-s55
Group  27 is from HL_06920.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_06920.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-F-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50             GUUUCUAC (   1) MLPS  -7.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUCAAGAU (   1) MLPS  -8.34 deficit   0.69 prct   0.00 CutScore  94.11;  Ed  0, 0 matches the original group, cWW-F-s35-s35-s35-s35
Group 172 is from HL_51284.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_51284.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-F-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GCAAGGAGAC (   1) MLPS  -7.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-s35-s35-s35-s35-s35-s35
Group 307 is from HL_98885.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_98885.3
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-F-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GAAGUGCACAC (   1) MLPS  -5.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GAAGUGCACAC (   1) MLPS  -5.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-F-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GAGGUGCACAC (   1) MLPS  -5.55 deficit   0.51 prct   0.00 CutScore  97.44;  Ed  0, 0 matches the original group, cWW-F-s35-s35-s35-s35-s35-s35-s35
Group 142 is from HL_43527.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_43527.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cSH-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               CUCCAG (   1) MLPS  -5.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              CGCCGAG (   1) MLPS  -6.67 deficit   0.77 prct   0.00 CutScore  91.89;  Ed  0, 0 matches the original group, cWW-cSH-s35-s35-s35-s35
Group 290 is from HL_94032.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_94032.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cSH-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UAGUCUCUUUCG (   1) MLPS  -9.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-s35-s35-s35-s35-s35-s35-s35
Group  34 is from HL_08602.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_08602.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cSS-s35-s35-s35-s35-s35-cSS-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CAAUCCGCUCUAG (   1) MLPS  -9.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSS-s35-s35-s35-s35-s35-cSS-s35-s55
Group  46 is from HL_14286.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_14286.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s33-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               CGGAUG (   1) MLPS  -3.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-F-F-s35
Group 189 is from HL_57204.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_57204.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s33-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               UGGAAA (   1) MLPS  -4.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-F-F-s35
Group 152 is from HL_46546.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_46546.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s33-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50                 CUCG (   1) MLPS  -3.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-F-s35
Better:   0 Equal:   1 Score 0.50                CUCUG (   1) MLPS  -4.30 deficit   0.47 prct   0.00 CutScore  95.05;  Ed  0, 0 matches the original group, cWW-s33-F-s35
Better:   0 Equal:   1 Score 0.50                 CUUG (   1) MLPS  -4.34 deficit   0.51 prct   0.00 CutScore  94.62;  Ed  0, 0 matches the original group, cWW-s33-F-s35
Better:   0 Equal:   4 Score 0.20               CGCGUG (   1) MLPS  -7.41 deficit   3.59 prct   0.00 CutScore  62.24;  Ed  0, 0 matches the original group, cWW-s33-F-s35
Group 138 is from HL_42671.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_42671.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s33-F-s35-tSS-s55-s33-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        AGCACGUGAAAUU (   1) MLPS  -8.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-F-s35-tSS-s55-s33-s35
Group 151 is from HL_46465.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_46465.1
This group is considered to be structured ***************************
Number of NTs: 22  Signature: cWW-s33-cHW-s55-s35-cWH-s53-s35-cHW-cWH-s53-s35-cWH-s35-cWH-s53-tWW-F-s55-cWH-s35-cWH-s35-tWW-s35-tHH-s53-s35-s53-tSW-s55-s55-s33-cSH-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 AGGAAGGUUUGGUAUGUGGUAUAU (   1) MLPS -23.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-cHW-s55-s35-cWH-s53-s35-cHW-cWH-s53-s35-cWH-s35-cWH-s53-tWW-F-s55-cWH-s35-cWH-s35-tWW-s35-tHH-s53-s35-s53-tSW-s55-s55-s33-cSH-s35-s35
Better:   0 Equal:   0 Score 1.00 AGGAAGGAUUGGUAUGUGGUAUAU (   1) MLPS -24.61 deficit   0.98 prct   0.00 CutScore  96.08;  Ed  0, 0 matches the original group, cWW-s33-cHW-s55-s35-cWH-s53-s35-cHW-cWH-s53-s35-cWH-s35-cWH-s53-tWW-F-s55-cWH-s35-cWH-s35-tWW-s35-tHH-s53-s35-s53-tSW-s55-s55-s33-cSH-s35-s35
Group 310 is from HL_99402.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_99402.3
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s33-s35-cSH-cSH-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CGAUUACCUG (   1) MLPS  -6.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-cSH-cSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UGAUUUGCUA (   1) MLPS  -7.12 deficit   0.67 prct   0.00 CutScore  96.47;  Ed  0, 0 matches the original group, cWW-s33-s35-cSH-cSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UGAUUUGCUA (   1) MLPS  -7.12 deficit   0.67 prct   0.00 CutScore  96.47;  Ed  0, 0 matches the original group, cWW-s33-s35-cSH-cSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UGGCUACCUG (   1) MLPS  -7.45 deficit   0.99 prct   0.00 CutScore  94.75;  Ed  0, 0 matches the original group, cWW-s33-s35-cSH-cSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UGCCAAGCUG (   1) MLPS  -7.74 deficit   1.29 prct   0.00 CutScore  93.20;  Ed  0, 0 matches the original group, cWW-s33-s35-cSH-cSH-s35-s35-s35-s35
Group 147 is from HL_44781.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_44781.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s33-s35-cWH-s53-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GUUCAC (   1) MLPS  -3.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-cWH-s53-s35-s35
Better:   0 Equal:   1 Score 0.50               GGGAAC (   1) MLPS  -4.77 deficit   0.97 prct   0.00 CutScore  89.77;  Ed  0, 0 matches the original group, cWW-s33-s35-cWH-s53-s35-s35
Group 201 is from HL_60357.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_60357.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s33-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GUAUUC (   1) MLPS  -3.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s35
Group 295 is from HL_95237.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_95237.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s33-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                UUUGA (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s35
Group  80 is from HL_24403.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_24403.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s33-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GAAAAUC (   1) MLPS  -5.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Group 169 is from HL_50959.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_50959.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s33-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UGAUGAG (   1) MLPS  -4.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Group 267 is from HL_86880.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_86880.4
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s33-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GCUCGUC (   1) MLPS  -5.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GGUCGUC (   1) MLPS  -5.45 deficit   0.25 prct   0.00 CutScore  97.35;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GGUCGUC (   1) MLPS  -5.45 deficit   0.25 prct   0.00 CutScore  97.35;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GACGAC (   1) MLPS  -5.55 deficit   0.36 prct   0.00 CutScore  96.24;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GACGAC (   1) MLPS  -5.55 deficit   0.36 prct   0.00 CutScore  96.24;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GACGAC (   1) MLPS  -5.55 deficit   0.36 prct   0.00 CutScore  96.24;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GCAAAUC (   1) MLPS  -5.83 deficit   0.64 prct   0.00 CutScore  93.31;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GCAAAUC (   1) MLPS  -5.83 deficit   0.64 prct   0.00 CutScore  93.31;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CAAGAG (   1) MLPS  -6.08 deficit   0.89 prct   0.00 CutScore  90.66;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GUUAAUC (   1) MLPS  -7.10 deficit   1.90 prct   0.00 CutScore  79.98;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              AGCAGUU (   1) MLPS  -7.28 deficit   2.09 prct   0.00 CutScore  78.03;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GCUGAUC (   1) MLPS  -7.30 deficit   2.10 prct   0.00 CutScore  77.87;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35
Group 220 is from HL_68742.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_68742.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s33-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CUUGCCAAG (   1) MLPS  -6.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s35-s35-s35-s35
Group 116 is from HL_35491.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_35491.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s33-s35-s55-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              GAAACAC (   1) MLPS  -3.47 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-s35-s35
Better:   0 Equal:   1 Score 0.50              GAAACAC (   1) MLPS  -3.47 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             GUAAAAGC (   1) MLPS  -6.37 deficit   2.89 prct   0.00 CutScore  74.26;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-s35-s35
Group 215 is from HL_67265.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_67265.4
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s33-s35-s55-tHW-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UUUGAUCCUGG (   1) MLPS  -7.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-tHW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          UUUGAUCCUGG (   1) MLPS  -7.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-tHW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GUUGAUCCUGC (   1) MLPS  -7.23 deficit   0.04 prct   0.00 CutScore  99.77;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-tHW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          UUUGAUCAUGG (   1) MLPS  -8.66 deficit   1.47 prct   0.00 CutScore  92.59;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-tHW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CGCCCGCCUGG (   1) MLPS  -9.77 deficit   2.58 prct   0.00 CutScore  86.95;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-tHW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CGACCGCCUGG (   1) MLPS  -9.77 deficit   2.58 prct   0.00 CutScore  86.95;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-tHW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CGACCGUCUGG (   1) MLPS -11.24 deficit   4.05 prct   0.00 CutScore  79.54;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-tHW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GACUGCAGAUC (   1) MLPS -17.74 deficit  10.55 prct   0.00 CutScore  46.69;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-tHW-s35-s35-s35-s35-s35-s35-s35
Group  71 is from HL_22443.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_22443.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s33-s35-s55-tWH-s35-tWH-s35-s55-s35-s35-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CCUGAGAAACGG (   1) MLPS  -6.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s35-s55-tWH-s35-tWH-s35-s55-s35-s35-s35-F
Group 163 is from HL_49816.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_49816.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s33-s55-s33
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GAAAGACC (   1) MLPS  -4.91 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s55-s33
Group 309 is from HL_99223.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_99223.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s33-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                UUUAA (   1) MLPS  -3.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-s55-s35
Better:   0 Equal:   1 Score 0.50                GGUAC (   1) MLPS  -3.60 deficit   0.06 prct   0.00 CutScore  99.36;  Ed  0, 0 matches the original group, cWW-s33-s55-s35
Better:   0 Equal:   0 Score 1.00                UCCAA (   1) MLPS  -4.05 deficit   0.51 prct   0.00 CutScore  94.62;  Ed  0, 0 matches the original group, cWW-s33-s55-s35
Group  51 is from HL_16845.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_16845.5
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s33-tHH-s53-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CUUAUCG (   1) MLPS  -4.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-tHH-s53-s35-s35
Better:   0 Equal:   0 Score 1.00              GUAAUCC (   1) MLPS  -4.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-tHH-s53-s35-s35
Group 114 is from HL_35010.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_35010.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s33-tHH-s53-s35-s35-cSH-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CUUGCAAAG (   1) MLPS  -6.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-tHH-s53-s35-s35-cSH-s35-s35
Group 162 is from HL_49223.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_49223.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s33-tHH-s53-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GAAAAAAGC (   1) MLPS  -6.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-tHH-s53-s35-s35-s35-s35
Group 225 is from HL_69774.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_69774.3
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s33-tSW-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              GAAACAC (   1) MLPS  -4.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-tSW-s35-s35-s35
Better:   0 Equal:   1 Score 0.50              GAAACAC (   1) MLPS  -4.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-tSW-s35-s35-s35
Better:   0 Equal:   1 Score 0.50              GAAACAC (   1) MLPS  -4.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-tSW-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GAACCCC (   1) MLPS  -6.83 deficit   2.57 prct   0.00 CutScore  72.92;  Ed  0, 0 matches the original group, cWW-s33-tSW-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGAACG (   1) MLPS  -6.88 deficit   2.62 prct   0.00 CutScore  72.38;  Ed  0, 0 matches the original group, cWW-s33-tSW-s35-s35-s35
Group  79 is from HL_24323.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_24323.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s33-tWW-s55-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GAAGUGCAAC (   1) MLPS  -6.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s33-tWW-s55-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UCAGAGGACA (   1) MLPS  -7.62 deficit   1.18 prct   0.00 CutScore  93.25;  Ed  0, 0 matches the original group, cWW-s33-tWW-s55-s35-s35-s35-s35-s35-s35
Group  49 is from HL_15942.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_15942.4
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               UUUAGG (   1) MLPS  -3.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   0 Score 1.00               UUUAGG (   1) MLPS  -3.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   0 Score 1.00               UUUAGG (   1) MLPS  -3.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   0 Score 1.00               UUGAGG (   1) MLPS  -3.87 deficit   0.59 prct   0.00 CutScore  93.81;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   0 Score 1.00               UCGAAG (   1) MLPS  -5.05 deficit   1.76 prct   0.00 CutScore  81.44;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   0 Score 1.00               CCUCAG (   1) MLPS  -7.17 deficit   3.89 prct   0.00 CutScore  59.06;  Ed  0, 0 matches the original group, cWW-s35
Group  82 is from HL_25183.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_25183.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              CUGUUCG (   1) MLPS  -5.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35
Group 188 is from HL_57052.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_57052.2
This group is considered to be structured ***************************
Number of NTs:  3  Signature: cWW-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                GUCAC (   1) MLPS  -2.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   0 Score 1.00                GUCAC (   1) MLPS  -2.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   0 Score 1.00                GUCAC (   1) MLPS  -2.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   0 Score 1.00                GUCAC (   1) MLPS  -2.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   0 Score 1.00                CUAAG (   1) MLPS  -4.14 deficit   1.34 prct   0.00 CutScore  85.86;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   1 Score 0.50                CUUUG (   1) MLPS  -4.92 deficit   2.13 prct   0.00 CutScore  77.56;  Ed  0, 0 matches the original group, cWW-s35
Better:   0 Equal:   0 Score 1.00                CCCUG (   1) MLPS  -5.09 deficit   2.30 prct   0.00 CutScore  75.80;  Ed  0, 0 matches the original group, cWW-s35
Group  59 is from HL_18722.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_18722.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33                GUCUC (   1) MLPS  -3.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F
Better:   0 Equal:   2 Score 0.33                GUCUC (   1) MLPS  -3.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F
Better:   0 Equal:   0 Score 1.00                 CGUG (   1) MLPS  -5.06 deficit   1.27 prct   0.00 CutScore  86.59;  Ed  0, 0 matches the original group, cWW-s35-F
Group  96 is from HL_30541.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_30541.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               CAUUCG (   1) MLPS  -4.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F-F
Group 292 is from HL_94386.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_94386.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GGUUUC (   1) MLPS  -6.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F-F-s35
Better:   0 Equal:   0 Score 1.00               CCUCGG (   1) MLPS  -6.39 deficit   0.10 prct   0.00 CutScore  98.95;  Ed  0, 0 matches the original group, cWW-s35-F-F-s35
Better:   0 Equal:   2 Score 0.33               GGCGAC (   1) MLPS  -6.80 deficit   0.51 prct   0.00 CutScore  94.62;  Ed  0, 0 matches the original group, cWW-s35-F-F-s35
Better:   0 Equal:   0 Score 1.00              GUGAAGC (   1) MLPS  -8.56 deficit   2.27 prct   0.00 CutScore  76.11;  Ed  0, 0 matches the original group, cWW-s35-F-F-s35
Group 285 is from HL_93436.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_93436.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            GUUCGAUCC (   1) MLPS  -5.67 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F-s35-s35
Group  95 is from HL_29487.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_29487.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-F-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               CUGAUG (   1) MLPS  -2.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F-s35-s55
Better:   0 Equal:   0 Score 1.00               CUGAUG (   1) MLPS  -2.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F-s35-s55
Better:   0 Equal:   0 Score 1.00               CUGAUG (   1) MLPS  -2.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F-s35-s55
Better:   0 Equal:   0 Score 1.00               CUGAUG (   1) MLPS  -2.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F-s35-s55
Group 110 is from HL_33507.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_33507.2
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-F-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                UUUUA (   1) MLPS  -2.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F-s55
Better:   0 Equal:   0 Score 1.00                UUUUA (   1) MLPS  -2.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-F-s55
Group  57 is from HL_18218.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_18218.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-bif-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33               GGCGAC (   1) MLPS  -7.31 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-F-F-s35
Better:   0 Equal:   0 Score 1.00            GCCUAGGAC (   1) MLPS  -7.59 deficit   0.27 prct   0.00 CutScore  97.14;  Ed  0, 0 matches the original group, cWW-s35-bif-F-F-s35
Group 167 is from HL_50537.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_50537.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-bif-F-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            ACUGUUAAU (   1) MLPS  -3.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUGUUAAU (   1) MLPS  -3.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUGUUAAC (   1) MLPS  -3.72 deficit   0.06 prct   0.00 CutScore  99.70;  Ed  0, 0 matches the original group, cWW-s35-bif-F-F-s35-s35
Group 179 is from HL_53760.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_53760.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            GGUAAGUUC (   1) MLPS  -5.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GGUAAGUUC (   1) MLPS  -5.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GGUAAGUUC (   1) MLPS  -5.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GGUAAGUUC (   1) MLPS  -5.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUGACUAC (   1) MLPS  -8.42 deficit   3.09 prct   0.00 CutScore  78.16;  Ed  0, 0 matches the original group, cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUGACUAC (   1) MLPS  -8.42 deficit   3.09 prct   0.00 CutScore  78.16;  Ed  0, 0 matches the original group, cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CAUCAGUAG (   1) MLPS  -8.58 deficit   3.25 prct   0.00 CutScore  77.04;  Ed  0, 0 matches the original group, cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            UCUAAUUAG (   1) MLPS  -8.75 deficit   3.42 prct   0.00 CutScore  75.85;  Ed  0, 0 matches the original group, cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CGUACAAG (   1) MLPS -10.64 deficit   5.32 prct   0.00 CutScore  62.44;  Ed  0, 0 matches the original group, cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GCAUUCGC (   1) MLPS -13.55 deficit   8.23 prct   0.00 CutScore  41.92;  Ed  0, 0 matches the original group, cWW-s35-bif-s33-s35-tSH-s35-s35-s35-s35
Group 199 is from HL_60140.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_60140.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-bif-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            ACUGAAGAU (   1) MLPS  -7.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GUCAAUGC (   1) MLPS  -7.71 deficit   0.60 prct   0.00 CutScore  95.35;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35
Group 198 is from HL_59710.7 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_59710.7
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-bif-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            ACUGAAAAU (   1) MLPS  -4.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUGAAAAU (   1) MLPS  -4.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUGAAAAU (   1) MLPS  -4.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUGAAAAU (   1) MLPS  -4.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUCAUAAU (   1) MLPS  -4.87 deficit   0.45 prct   0.00 CutScore  96.97;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUCAUAAC (   1) MLPS  -5.16 deficit   0.74 prct   0.00 CutScore  95.02;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUCAUAAC (   1) MLPS  -5.16 deficit   0.74 prct   0.00 CutScore  95.02;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUCAUAAC (   1) MLPS  -5.16 deficit   0.74 prct   0.00 CutScore  95.02;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUCAUAAC (   1) MLPS  -5.16 deficit   0.74 prct   0.00 CutScore  95.02;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUGAUAAC (   1) MLPS  -5.16 deficit   0.74 prct   0.00 CutScore  95.02;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUGAUAAC (   1) MLPS  -5.16 deficit   0.74 prct   0.00 CutScore  95.02;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            UCUCGAAAA (   1) MLPS  -6.27 deficit   1.86 prct   0.00 CutScore  87.55;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUCCAGAU (   1) MLPS  -6.38 deficit   1.96 prct   0.00 CutScore  86.85;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUCCAGAU (   1) MLPS  -6.38 deficit   1.96 prct   0.00 CutScore  86.85;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUCCAGAU (   1) MLPS  -6.38 deficit   1.96 prct   0.00 CutScore  86.85;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUCCAGAU (   1) MLPS  -6.38 deficit   1.96 prct   0.00 CutScore  86.85;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUUCAAAU (   1) MLPS  -6.56 deficit   2.14 prct   0.00 CutScore  85.65;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUUCAAAU (   1) MLPS  -6.56 deficit   2.14 prct   0.00 CutScore  85.65;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            AUUGAAAAU (   1) MLPS  -6.85 deficit   2.44 prct   0.00 CutScore  83.69;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            AUUGAAAAU (   1) MLPS  -6.85 deficit   2.44 prct   0.00 CutScore  83.69;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CCUUACAAG (   1) MLPS  -7.10 deficit   2.69 prct   0.00 CutScore  82.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUGUAGAU (   1) MLPS  -7.27 deficit   2.85 prct   0.00 CutScore  80.91;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUGUAGAU (   1) MLPS  -7.27 deficit   2.85 prct   0.00 CutScore  80.91;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CCUCUCAAG (   1) MLPS  -7.29 deficit   2.88 prct   0.00 CutScore  80.74;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            AUUGCAAAU (   1) MLPS  -7.57 deficit   3.16 prct   0.00 CutScore  78.85;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            UUUCACAAA (   1) MLPS  -8.28 deficit   3.87 prct   0.00 CutScore  74.10;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUAAUCAC (   1) MLPS  -9.29 deficit   4.87 prct   0.00 CutScore  67.36;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CUUGGCAAG (   1) MLPS  -9.47 deficit   5.06 prct   0.00 CutScore  66.12;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CGUCGUCGG (   1) MLPS -11.20 deficit   6.78 prct   0.00 CutScore  54.57;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CGUCGUCGG (   1) MLPS -11.20 deficit   6.78 prct   0.00 CutScore  54.57;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CUCGACACG (   1) MLPS -12.78 deficit   8.36 prct   0.00 CutScore  44.00;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50           UCAAGCCUAG (   1) MLPS -18.25 deficit  13.84 prct   0.00 CutScore   7.35;  Ed  0, 0 matches the original group, cWW-s35-bif-s35-s35-s35-s35-s35-s35
Group 107 is from HL_32617.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_32617.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-cSH
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GUGGUC (   1) MLPS  -3.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSH
Better:   0 Equal:   0 Score 1.00               GUGGUC (   1) MLPS  -3.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSH
Better:   0 Equal:   0 Score 1.00               GUGGUC (   1) MLPS  -3.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSH
Better:   0 Equal:   0 Score 1.00               GUGGUC (   1) MLPS  -3.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSH
Better:   0 Equal:   0 Score 1.00               CUGGUG (   1) MLPS  -3.87 deficit   0.13 prct   0.00 CutScore  98.64;  Ed  0, 0 matches the original group, cWW-s35-cSH
Better:   0 Equal:   0 Score 1.00               CUGGUG (   1) MLPS  -3.87 deficit   0.13 prct   0.00 CutScore  98.64;  Ed  0, 0 matches the original group, cWW-s35-cSH
Better:   0 Equal:   0 Score 1.00               UUGGUA (   1) MLPS  -3.88 deficit   0.14 prct   0.00 CutScore  98.52;  Ed  0, 0 matches the original group, cWW-s35-cSH
Better:   0 Equal:   0 Score 1.00               UUGGUA (   1) MLPS  -3.88 deficit   0.14 prct   0.00 CutScore  98.52;  Ed  0, 0 matches the original group, cWW-s35-cSH
Better:   0 Equal:   0 Score 1.00                GAGUC (   1) MLPS  -7.35 deficit   3.61 prct   0.00 CutScore  62.01;  Ed  0, 0 matches the original group, cWW-s35-cSH
Group 240 is from HL_75091.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_75091.3
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-cSH-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGUCCCAGAC (   1) MLPS  -9.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UGCUAAUCUG (   1) MLPS -11.45 deficit   1.57 prct   0.00 CutScore  89.22;  Ed  0, 0 matches the original group, cWW-s35-cSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GUUUGCGGGAC (   1) MLPS -12.08 deficit   2.20 prct   0.00 CutScore  84.95;  Ed  0, 0 matches the original group, cWW-s35-cSH-s35-s35-s35-s35-s35
Group  99 is from HL_30819.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_30819.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-cSH-s35-tSS-s55-s33-s53-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           AUUGAGAGCU (   1) MLPS  -8.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSH-s35-tSS-s55-s33-s53-s55
Group  33 is from HL_08510.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_08510.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-cSH-s53-s53-F-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AUGUGCUUU (   1) MLPS  -5.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSH-s53-s53-F-s55
Better:   0 Equal:   0 Score 1.00            AUGUGCUUU (   1) MLPS  -5.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSH-s53-s53-F-s55
Group  43 is from HL_12710.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_12710.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-s35-cSH-s55-cWW-s35-s35-s35-s55-tSH-s35-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     GAAAGCGUAAUAGCUC (   1) MLPS -11.55 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSH-s55-cWW-s35-s35-s35-s55-tSH-s35-s35-s35-s35-s35-s35-s35-s35
Group 118 is from HL_35894.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_35894.3
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-cSW-s33-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               UAGUAA (   1) MLPS  -3.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSW-s33-F-s35
Better:   0 Equal:   0 Score 1.00               UAGUAA (   1) MLPS  -3.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSW-s33-F-s35
Better:   0 Equal:   0 Score 1.00               UAGUAA (   1) MLPS  -3.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSW-s33-F-s35
Better:   0 Equal:   0 Score 1.00               UAGUAA (   1) MLPS  -3.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSW-s33-F-s35
Better:   0 Equal:   1 Score 0.50               CAACCG (   1) MLPS  -8.38 deficit   4.54 prct   0.00 CutScore  54.21;  Ed  0, 0 matches the original group, cWW-s35-cSW-s33-F-s35
Better:   0 Equal:   0 Score 1.00             GAAGGAUC (   1) MLPS  -9.62 deficit   5.78 prct   0.00 CutScore  41.67;  Ed  0, 0 matches the original group, cWW-s35-cSW-s33-F-s35
Group 299 is from HL_96776.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_96776.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-cSW-s35-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               AAAAUU (   1) MLPS  -5.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s35-F
Better:   0 Equal:   1 Score 0.50               CAACCG (   1) MLPS  -5.66 deficit   0.28 prct   0.00 CutScore  97.05;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s35-F
Better:   0 Equal:   0 Score 1.00               CCUUUG (   1) MLPS  -5.77 deficit   0.39 prct   0.00 CutScore  95.93;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s35-F
Group  18 is from HL_05018.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_05018.4
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-cSW-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GAAGACGAC (   1) MLPS  -5.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GAAGACCAC (   1) MLPS  -5.70 deficit   0.59 prct   0.00 CutScore  96.36;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GAAGACCAC (   1) MLPS  -5.70 deficit   0.59 prct   0.00 CutScore  96.36;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            AAAGAUGAU (   1) MLPS  -6.40 deficit   1.29 prct   0.00 CutScore  92.01;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUAUACGAC (   1) MLPS  -7.03 deficit   1.92 prct   0.00 CutScore  88.08;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUACAAGAC (   1) MLPS  -8.13 deficit   3.02 prct   0.00 CutScore  81.27;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s35-s35-s35-s35
Group 133 is from HL_41207.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_41207.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-cSW-s35-s53-tWH-s35-s55-s35-s53-s33-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UCUUUAAAA (   1) MLPS  -6.55 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s53-tWH-s35-s55-s35-s53-s33-s35
Better:   0 Equal:   0 Score 1.00         AUUGUAAUUAUU (   1) MLPS  -9.81 deficit   3.26 prct   0.00 CutScore  80.10;  Ed  0, 0 matches the original group, cWW-s35-cSW-s35-s53-tWH-s35-s55-s35-s53-s33-s35
Group 153 is from HL_46771.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_46771.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-cSW-tSS-cSS-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            AUUGAAAAU (   1) MLPS  -7.42 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cSW-tSS-cSS-s55-s35
Group 185 is from HL_56387.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_56387.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-cWH-s35-s53-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                AUUUU (   1) MLPS  -5.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWH-s35-s53-s55
Better:   0 Equal:   0 Score 1.00             ACGCGUGU (   1) MLPS  -9.57 deficit   4.47 prct   0.00 CutScore  52.94;  Ed  0, 0 matches the original group, cWW-s35-cWH-s35-s53-s55
Group 180 is from HL_53987.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_53987.3
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-cWS-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                CUUAG (   1) MLPS  -3.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWS-s35
Better:   0 Equal:   0 Score 1.00                CUUAG (   1) MLPS  -3.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWS-s35
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -5.91 deficit   2.06 prct   0.00 CutScore  78.33;  Ed  0, 0 matches the original group, cWW-s35-cWS-s35
Group  26 is from HL_06645.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_06645.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-cWW-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CUUCAACG (   1) MLPS  -5.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-F-F-s35
Group  58 is from HL_18495.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_18495.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-cWW-cSH-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            ACUGCAGAU (   1) MLPS  -6.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-cSH-s35-s35-s35
Group 235 is from HL_73051.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_73051.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-cWW-s33-cWH-s35-cWH-s53-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GAGGAGGUC (   1) MLPS  -5.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s33-cWH-s35-cWH-s53-s35-s35-s35
Group  47 is from HL_14725.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_14725.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-cWW-s33-s53-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UUCAGUGUG (   1) MLPS  -4.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s33-s53-s35-s35-s35-s35
Group 160 is from HL_49196.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_49196.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-cWW-s33-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AUUCCCAUU (   1) MLPS  -5.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s33-s55-s35
Better:   0 Equal:   0 Score 1.00            AUUCCCAUU (   1) MLPS  -5.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s33-s55-s35
Better:   0 Equal:   0 Score 1.00            AUUCCCAUU (   1) MLPS  -5.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s33-s55-s35
Better:   0 Equal:   0 Score 1.00              CGUUGAG (   1) MLPS  -9.70 deficit   3.77 prct   0.00 CutScore  69.05;  Ed  0, 0 matches the original group, cWW-s35-cWW-s33-s55-s35
Group 128 is from HL_38011.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_38011.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-s35-cWW-s35-F-F-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GCUUAGAAGCAGCC (   1) MLPS  -7.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-F-F-s35-s35-s35-s35
Group 237 is from HL_73266.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_73266.3
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GCCUUAAAC (   1) MLPS  -5.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCCUUAAAC (   1) MLPS  -5.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCCUUAAAC (   1) MLPS  -5.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCCUUAAAC (   1) MLPS  -5.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCCUUAAAC (   1) MLPS  -5.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACCGUAAAU (   1) MLPS  -5.81 deficit   0.16 prct   0.00 CutScore  98.95;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACCGUAAAU (   1) MLPS  -5.81 deficit   0.16 prct   0.00 CutScore  98.95;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACCGUAAAU (   1) MLPS  -5.81 deficit   0.16 prct   0.00 CutScore  98.95;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUGUAAAU (   1) MLPS  -5.90 deficit   0.24 prct   0.00 CutScore  98.35;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUUCAAAC (   1) MLPS  -5.93 deficit   0.27 prct   0.00 CutScore  98.16;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUUCAAAC (   1) MLPS  -5.93 deficit   0.27 prct   0.00 CutScore  98.16;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            ACUCUAAAU (   1) MLPS  -6.20 deficit   0.54 prct   0.00 CutScore  96.35;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-cSW-cSH-s55-s35-s35-s35
Group 211 is from HL_67044.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_67044.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-cWW-s35-s33-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AUGUCGUUU (   1) MLPS  -5.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s33-F-s35
Group  88 is from HL_27335.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_27335.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-cWW-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            ACUGCAGAU (   1) MLPS  -6.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35
Better:   0 Equal:   1 Score 0.50            ACUGCAGAU (   1) MLPS  -6.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35
Group 272 is from HL_89082.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_89082.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-cWW-s35-s35-s35-F-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GAAGAAUACGACC (   1) MLPS  -4.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35-s35-F-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        GAAGAAUACGACC (   1) MLPS  -4.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35-s35-F-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        GAAGAAUACGACC (   1) MLPS  -4.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35-s35-F-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        GAAGAAUACGACC (   1) MLPS  -4.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35-s35-F-s35-s35-s35
Group 278 is from HL_91131.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_91131.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-cWW-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GCUUUGGAC (   1) MLPS  -5.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35-s35-s35
Group  19 is from HL_05123.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_05123.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-cWW-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UUCCUCCCG (   1) MLPS  -7.68 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            UUCCUCCCG (   1) MLPS  -7.68 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           ACGGGGAGUU (   1) MLPS  -8.59 deficit   0.91 prct   0.00 CutScore  94.28;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           ACGGGGAGUU (   1) MLPS  -8.59 deficit   0.91 prct   0.00 CutScore  94.28;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s35-s35-s35-s35-s35
Group  66 is from HL_19958.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_19958.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-cWW-s35-s55-cWS-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GUAGUGGUAUC (   1) MLPS  -7.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-cWS-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GUAGUGGUAUC (   1) MLPS  -7.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-cWS-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GUAGUGGUAUC (   1) MLPS  -7.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-cWS-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          AGAGGGGCUUU (   1) MLPS  -9.09 deficit   1.75 prct   0.00 CutScore  90.45;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-cWS-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          AGAGGGGCUUU (   1) MLPS  -9.09 deficit   1.75 prct   0.00 CutScore  90.45;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-cWS-s35-s35-s35
Group 143 is from HL_43610.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_43610.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-cWW-s35-s55-s33-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GGAGACC (   1) MLPS  -3.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s33-F-s35
Better:   0 Equal:   0 Score 1.00              GGAGACC (   1) MLPS  -3.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s33-F-s35
Better:   0 Equal:   1 Score 0.50          CAAGCGGUAAG (   1) MLPS -10.80 deficit   7.39 prct   0.00 CutScore  51.70;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s33-F-s35
Group   2 is from HL_00996.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_00996.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-cWW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GUCUUC (   1) MLPS  -3.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35
Group 284 is from HL_93229.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_93229.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-cWW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CCUUGAG (   1) MLPS  -4.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35
Group  37 is from HL_10536.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_10536.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-cWW-s35-s55-s35-s35-s33-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GUUGGAUAUC (   1) MLPS  -5.00 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s35-s33-F-s35
Group 181 is from HL_54035.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_54035.5
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-cWW-s35-s55-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GUUAAGUC (   1) MLPS  -4.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GUUAAGUC (   1) MLPS  -4.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GUUAAGUC (   1) MLPS  -4.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             AUUGAGUU (   1) MLPS  -4.83 deficit   0.56 prct   0.00 CutScore  95.35;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             AUUGAGUU (   1) MLPS  -4.83 deficit   0.56 prct   0.00 CutScore  95.35;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CUUAAUUG (   1) MLPS  -5.32 deficit   1.05 prct   0.00 CutScore  91.19;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CUUAAUUG (   1) MLPS  -5.32 deficit   1.05 prct   0.00 CutScore  91.19;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50              GUUUAUC (   1) MLPS  -6.86 deficit   2.59 prct   0.00 CutScore  78.29;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UUUGGGAAUG (   1) MLPS -12.73 deficit   8.46 prct   0.00 CutScore  29.17;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s35-s35
Group  44 is from HL_12773.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_12773.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-s35-cWW-s35-s55-s35-s55-s33-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GUAUUGCAGUACCUC (   1) MLPS  -9.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-s55-s33-s35-s35-s35
Group  53 is from HL_17086.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_17086.2
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-s35-cWW-s35-s55-s35-tSH-s35-tSH-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GAGGUAGCGGUGC (   1) MLPS -10.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-tSH-s35-tSH-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        AAUGUAAAUACCU (   1) MLPS -11.99 deficit   1.03 prct   0.00 CutScore  94.64;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-tSH-s35-tSH-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        CGGCUACGAACCG (   1) MLPS -13.08 deficit   2.11 prct   0.00 CutScore  89.02;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s35-tSH-s35-tSH-s35-s35-s35-s35-s35-s35-s35
Group 186 is from HL_56500.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_56500.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-cWW-s35-s55-s55-cSH-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GUUUUGUAAUC (   1) MLPS  -7.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s55-cSH-s35
Group 281 is from HL_92488.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_92488.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-s35-cWW-s35-s55-s55-s35-s35-cSS-s35-cSS-s35-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     GAAACCGCCGAUAUGC (   1) MLPS -12.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-s55-s35-s35-cSS-s35-cSS-s35-F-s35
Group  22 is from HL_05832.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_05832.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-cWW-s35-s55-tSW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GCGAAAGAC (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-tSW-s35-s55-s35
Group 200 is from HL_60326.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_60326.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-cWW-s35-s55-tWH-s35-s33-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GUUUACCAAAAUC (   1) MLPS  -7.82 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-s55-tWH-s35-s33-s35-s35
Group  35 is from HL_08748.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_08748.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-cWW-s35-tSH-s33-s35-s35-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AUGAGAAUU (   1) MLPS  -6.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-tSH-s33-s35-s35-F-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUCAUACU (   1) MLPS  -8.18 deficit   1.24 prct   0.00 CutScore  91.18;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-tSH-s33-s35-s35-F-s35-s35
Group 126 is from HL_37694.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_37694.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-cWW-s35-tSH-s35-s35-s35-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -4.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-tSH-s35-s35-s35-F-s35
Group  67 is from HL_20714.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_20714.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-cWW-s35-tWH-s33-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        AAUGGGAUGUCGU (   1) MLPS  -8.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-tWH-s33-s35-s35-s35-s35-s35-s35-s35
Group 165 is from HL_49992.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_49992.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-cWW-s35-tWH-s35-tWH-s33-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GGAUAAAAGAC (   1) MLPS  -7.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-tWH-s35-tWH-s33-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GAUCAGAAUGC (   1) MLPS  -8.50 deficit   0.92 prct   0.00 CutScore  94.49;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-tWH-s35-tWH-s33-s35-s35-s35-s35-s35
Group 228 is from HL_70505.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_70505.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-cWW-s35-tWW-s35-s35-s35-F-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50         GAUCAGCCAUGC (   1) MLPS  -6.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-cWW-s35-tWW-s35-s35-s35-F-s55-s35
Group 224 is from HL_69677.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_69677.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s33-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CUUUUUG (   1) MLPS  -4.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-F
Group 195 is from HL_59297.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_59297.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s33-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GCUUAGGC (   1) MLPS  -5.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-F-F
Group 123 is from HL_36552.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_36552.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s33-F-s55-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CCUCCUAAG (   1) MLPS  -6.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-F-s55-F
Group 287 is from HL_93573.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_93573.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s33-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CCUUGUG (   1) MLPS  -5.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-s35
Group 141 is from HL_43488.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_43488.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s33-s35-cWW-s35-s55-s35-F-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         AACGCUUGCGUU (   1) MLPS  -8.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-s35-cWW-s35-s55-s35-F-F-F-s35
Group 146 is from HL_44769.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_44769.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s33-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CGCACGGAG (   1) MLPS  -6.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-s35-s35-s35
Group 279 is from HL_91503.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_91503.2
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-s33-s35-s55-s33-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GUUCGUGGAGC (   1) MLPS  -6.99 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00          GUUCGUGAAAC (   1) MLPS  -6.99 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00          ACACGUGGUAU (   1) MLPS  -8.07 deficit   1.08 prct   0.00 CutScore  94.24;  Ed  0, 0 matches the original group, cWW-s35-s33-s35-s55-s33-s35
Group  12 is from HL_02906.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_02906.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s33-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               UGUAAG (   1) MLPS  -7.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-s35-s55-s35
Better:   0 Equal:   0 Score 1.00             GAUAUGGC (   1) MLPS  -8.80 deficit   1.73 prct   0.00 CutScore  81.82;  Ed  0, 0 matches the original group, cWW-s35-s33-s35-s55-s35
Group 242 is from HL_76406.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_76406.3
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-s33-s53-s53-cWH-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GACAGAGAC (   1) MLPS  -5.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-s53-s53-cWH-s55-s35
Better:   0 Equal:   0 Score 1.00            AACAGAAAU (   1) MLPS  -5.29 deficit   0.06 prct   0.00 CutScore  99.59;  Ed  0, 0 matches the original group, cWW-s35-s33-s53-s53-cWH-s55-s35
Group 303 is from HL_98248.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_98248.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-s33-s55-s55-tHW-s55-s35-s35-s35-cSH-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GUAACUAUGAC (   1) MLPS  -5.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s33-s55-s55-tHW-s55-s35-s35-s35-cSH-s35
Group  60 is from HL_18785.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_18785.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               UAAGGG (   1) MLPS  -3.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35
Group  14 is from HL_03603.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_03603.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-s35-s35-F-s35-s35-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      AUUUUGUUGGUUUCU (   1) MLPS -10.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-F-s35-s35-s35-s35-s35-s35-s35-s35-s35
Group 100 is from HL_30937.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_30937.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UUAACUG (   1) MLPS  -4.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GUAACGC (   1) MLPS  -4.57 deficit   0.34 prct   0.00 CutScore  96.80;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Group 308 is from HL_98995.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_98995.6
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               UGCCAA (   1) MLPS  -4.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGCCAA (   1) MLPS  -4.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UACCAA (   1) MLPS  -5.14 deficit   0.96 prct   0.00 CutScore  89.94;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -5.22 deficit   1.03 prct   0.00 CutScore  89.12;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGCCCG (   1) MLPS  -5.23 deficit   1.04 prct   0.00 CutScore  89.04;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -5.77 deficit   1.59 prct   0.00 CutScore  83.31;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAUCA (   1) MLPS  -6.64 deficit   2.46 prct   0.00 CutScore  74.15;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50              GUCCCGC (   1) MLPS  -9.76 deficit   5.57 prct   0.00 CutScore  41.33;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GCUAAAAC (   1) MLPS -10.01 deficit   5.83 prct   0.00 CutScore  38.68;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35
Group  85 is from HL_26055.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_26055.5
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50             GUUUCUAC (   1) MLPS  -4.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50             GUUUCUAC (   1) MLPS  -4.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50             GUUUCUAC (   1) MLPS  -4.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50             GUUUCUAC (   1) MLPS  -4.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GUUUUAC (   1) MLPS  -5.29 deficit   0.33 prct   0.00 CutScore  96.78;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GCUCAAC (   1) MLPS  -5.91 deficit   0.95 prct   0.00 CutScore  90.76;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GCUCAAC (   1) MLPS  -5.91 deficit   0.95 prct   0.00 CutScore  90.76;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GCUCAAC (   1) MLPS  -5.91 deficit   0.95 prct   0.00 CutScore  90.76;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GCUUCCAC (   1) MLPS  -6.57 deficit   1.60 prct   0.00 CutScore  84.44;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GCUUCCAC (   1) MLPS  -6.57 deficit   1.60 prct   0.00 CutScore  84.44;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50              CUGUUCG (   1) MLPS  -7.60 deficit   2.64 prct   0.00 CutScore  74.41;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50              CUGUUCG (   1) MLPS  -7.60 deficit   2.64 prct   0.00 CutScore  74.41;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              UUGUUCA (   1) MLPS  -7.70 deficit   2.74 prct   0.00 CutScore  73.38;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              CUGCGUG (   1) MLPS  -9.02 deficit   4.06 prct   0.00 CutScore  60.58;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            ACUCUGGAU (   1) MLPS -12.81 deficit   7.85 prct   0.00 CutScore  23.80;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Group 105 is from HL_32512.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_32512.6
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GACUGGC (   1) MLPS  -5.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GACUGGC (   1) MLPS  -5.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GACUGGC (   1) MLPS  -5.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GACUGGC (   1) MLPS  -5.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GACUGGC (   1) MLPS  -5.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GACUGGC (   1) MLPS  -5.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GGACCACC (   1) MLPS  -7.03 deficit   1.67 prct   0.00 CutScore  84.23;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GGACCACC (   1) MLPS  -7.03 deficit   1.67 prct   0.00 CutScore  84.23;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GGACCAUC (   1) MLPS  -7.37 deficit   2.01 prct   0.00 CutScore  81.06;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GGACCAUC (   1) MLPS  -7.37 deficit   2.01 prct   0.00 CutScore  81.06;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50              GUCCCGC (   1) MLPS  -7.62 deficit   2.27 prct   0.00 CutScore  78.65;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GUGGCAGC (   1) MLPS  -9.24 deficit   3.89 prct   0.00 CutScore  63.36;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GUGGCAGC (   1) MLPS  -9.24 deficit   3.89 prct   0.00 CutScore  63.36;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GCUGGAC (   1) MLPS -10.61 deficit   5.25 prct   0.00 CutScore  50.50;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              UUUCCAG (   1) MLPS -12.37 deficit   7.01 prct   0.00 CutScore  33.92;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GACGGACAC (   1) MLPS -15.33 deficit   9.98 prct   0.00 CutScore   5.97;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Group 250 is from HL_80105.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_80105.3
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GCGCCAGC (   1) MLPS  -6.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             ACUUCGGU (   1) MLPS  -7.21 deficit   0.57 prct   0.00 CutScore  95.54;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGUAAAAC (   1) MLPS  -9.02 deficit   2.38 prct   0.00 CutScore  81.28;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Group 282 is from HL_92681.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_92681.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             UGAAGAAG (   1) MLPS  -3.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             UGAAGAAG (   1) MLPS  -3.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             UGCAGAAG (   1) MLPS  -3.92 deficit   0.34 prct   0.00 CutScore  97.15;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             UGAAGUAG (   1) MLPS  -4.37 deficit   0.79 prct   0.00 CutScore  93.32;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             AGCAGAAU (   1) MLPS  -5.89 deficit   2.31 prct   0.00 CutScore  80.43;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             UGUAGUCG (   1) MLPS  -6.00 deficit   2.42 prct   0.00 CutScore  79.45;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GUUUAAUC (   1) MLPS -11.59 deficit   8.01 prct   0.00 CutScore  32.13;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35
Group 283 is from HL_93221.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_93221.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-s35-s35-s35-s35-s35-F-F-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50       GACCUAGAUCACCC (   1) MLPS  -9.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-F-F-s35-s35-s35
Group 149 is from HL_46142.7 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_46142.7
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CGCAAGGG (   1) MLPS  -7.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GUUAGGGC (   1) MLPS  -8.11 deficit   0.52 prct   0.00 CutScore  94.52;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CGCAAAGG (   1) MLPS  -8.35 deficit   0.76 prct   0.00 CutScore  91.98;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CAAAAGGG (   1) MLPS  -8.37 deficit   0.78 prct   0.00 CutScore  91.80;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             UGCAAUGG (   1) MLPS  -8.46 deficit   0.87 prct   0.00 CutScore  90.85;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GUUCGGGC (   1) MLPS  -8.96 deficit   1.37 prct   0.00 CutScore  85.61;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             UGCAAGAG (   1) MLPS  -9.17 deficit   1.58 prct   0.00 CutScore  83.36;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             UGUAAAGG (   1) MLPS  -9.18 deficit   1.59 prct   0.00 CutScore  83.27;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             UUACUUGA (   1) MLPS  -9.64 deficit   2.05 prct   0.00 CutScore  78.46;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GACCCCGC (   1) MLPS  -9.82 deficit   2.23 prct   0.00 CutScore  76.54;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GACCCCGC (   1) MLPS  -9.82 deficit   2.23 prct   0.00 CutScore  76.54;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GUUUGAGC (   1) MLPS  -9.97 deficit   2.38 prct   0.00 CutScore  74.94;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CCUGGGAG (   1) MLPS -11.05 deficit   3.46 prct   0.00 CutScore  63.57;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAUCAC (   1) MLPS -11.27 deficit   3.68 prct   0.00 CutScore  61.29;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCUUGAUGC (   1) MLPS -12.15 deficit   4.56 prct   0.00 CutScore  52.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CGGAAUUUG (   1) MLPS -12.18 deficit   4.59 prct   0.00 CutScore  51.66;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GGCAUCGAC (   1) MLPS -13.40 deficit   5.81 prct   0.00 CutScore  38.89;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           GGUAAAUUCC (   1) MLPS -14.56 deficit   6.96 prct   0.00 CutScore  26.70;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            UACCUUCUG (   1) MLPS -14.67 deficit   7.08 prct   0.00 CutScore  25.47;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           GAUGAGGCCC (   1) MLPS -15.48 deficit   7.89 prct   0.00 CutScore  16.97;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Group 154 is from HL_46891.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_46891.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CUGGGGCGG (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CUGGGGCGG (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CUGGGGCGG (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CUGGGGCGG (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             AUGGUUGU (   1) MLPS  -6.59 deficit   0.25 prct   0.00 CutScore  97.88;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             AUGGUUGU (   1) MLPS  -6.59 deficit   0.25 prct   0.00 CutScore  97.88;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GCGAUCAC (   1) MLPS  -8.81 deficit   2.47 prct   0.00 CutScore  79.01;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GCGAUCAC (   1) MLPS  -8.81 deficit   2.47 prct   0.00 CutScore  79.01;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             UUAGGUAG (   1) MLPS  -9.77 deficit   3.43 prct   0.00 CutScore  70.84;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GGUGAGCC (   1) MLPS -11.20 deficit   4.86 prct   0.00 CutScore  58.68;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50             GGUUGGCC (   1) MLPS -11.47 deficit   5.13 prct   0.00 CutScore  56.40;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Group 208 is from HL_63693.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_63693.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UGCAUAACAA (   1) MLPS  -7.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35
Group  55 is from HL_17926.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_17926.4
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GCUCAAAGC (   1) MLPS  -8.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            UGUAAGUAA (   1) MLPS  -9.22 deficit   1.14 prct   0.00 CutScore  89.90;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CGGUAGCGG (   1) MLPS  -9.82 deficit   1.74 prct   0.00 CutScore  84.62;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GCCCUAAGC (   1) MLPS -10.03 deficit   1.95 prct   0.00 CutScore  82.83;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            UGAUAUGAA (   1) MLPS -10.07 deficit   1.99 prct   0.00 CutScore  82.42;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UACUCCUUCG (   1) MLPS -13.00 deficit   4.92 prct   0.00 CutScore  56.54;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35
Group  15 is from HL_03847.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_03847.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GCUGGCGGUC (   1) MLPS  -6.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35-s35
Group 168 is from HL_50622.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_50622.6
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s35-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CCUUGGUAAGG (   1) MLPS  -9.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GAUUGUGAUUC (   1) MLPS  -9.44 deficit   0.29 prct   0.00 CutScore  98.33;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CCUUGAGGUGG (   1) MLPS  -9.66 deficit   0.51 prct   0.00 CutScore  97.05;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GGUUCGGCGUC (   1) MLPS -10.46 deficit   1.31 prct   0.00 CutScore  92.42;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50         GAUCAGCCAUGC (   1) MLPS -13.09 deficit   3.94 prct   0.00 CutScore  77.22;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-s35-s35-s35-s35-s35-s35
Group  54 is from HL_17899.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_17899.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s35-s35-tSW-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GUGUCUAC (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s35-tSW-s35-s35-s35
Group 182 is from HL_55046.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_55046.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              GUUUAUC (   1) MLPS  -4.52 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s55
Group 190 is from HL_58200.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_58200.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CCUCACACG (   1) MLPS  -7.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-s55
Group 139 is from HL_42733.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_42733.3
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s35-tSH-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AUUCUGAUU (   1) MLPS  -8.31 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUAAUACC (   1) MLPS  -8.81 deficit   0.50 prct   0.00 CutScore  95.60;  Ed  0, 0 matches the original group, cWW-s35-s35-tSH-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CGGCGAAAG (   1) MLPS  -9.17 deficit   0.86 prct   0.00 CutScore  92.49;  Ed  0, 0 matches the original group, cWW-s35-s35-tSH-s35-s35-s35-s35
Group 191 is from HL_58446.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_58446.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-s35-s35-tSW-s35-s53-F-F-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50       GACCUAGAUCACCC (   1) MLPS  -7.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s35-tSW-s35-s53-F-F-s35-s35-s35
Group 286 is from HL_93551.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_93551.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s53-F-s35-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CAUGGACG (   1) MLPS  -6.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s53-F-s35-s35-s55
Better:   0 Equal:   0 Score 1.00            CGACGGUUG (   1) MLPS  -7.55 deficit   0.69 prct   0.00 CutScore  94.81;  Ed  0, 0 matches the original group, cWW-s35-s53-F-s35-s35-s55
Group  70 is from HL_20891.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_20891.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s53-s33-F-s55-s35-s53-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CAAUAUCGAAG (   1) MLPS  -6.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s53-s33-F-s55-s35-s53-s55
Group  72 is from HL_22447.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_22447.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-s53-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               UUUUCA (   1) MLPS  -5.60 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s53-s55
Better:   0 Equal:   1 Score 0.50               UUUUCA (   1) MLPS  -5.60 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00                 GGUC (   1) MLPS  -5.90 deficit   0.30 prct   0.00 CutScore  96.87;  Ed  0, 0 matches the original group, cWW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00                 GGUC (   1) MLPS  -5.90 deficit   0.30 prct   0.00 CutScore  96.87;  Ed  0, 0 matches the original group, cWW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00              UACUAUA (   1) MLPS  -7.34 deficit   1.74 prct   0.00 CutScore  81.70;  Ed  0, 0 matches the original group, cWW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00              UACUAUA (   1) MLPS  -7.34 deficit   1.74 prct   0.00 CutScore  81.70;  Ed  0, 0 matches the original group, cWW-s35-s53-s55
Group  81 is from HL_24625.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_24625.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s53-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                CAGUG (   1) MLPS  -2.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00                CAGUG (   1) MLPS  -2.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s53-s55
Group  21 is from HL_05692.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_05692.1
This group is considered to be structured ***************************
Number of NTs:  3  Signature: cWW-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               CGUAGG (   1) MLPS  -5.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Group 124 is from HL_36982.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_36982.3
This group is considered to be structured ***************************
Number of NTs:  3  Signature: cWW-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                CUGUG (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                CUGUG (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                CUGUG (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                CUGUG (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                AUAUU (   1) MLPS  -3.83 deficit   0.39 prct   0.00 CutScore  95.89;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                AUAUU (   1) MLPS  -3.83 deficit   0.39 prct   0.00 CutScore  95.89;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   2 Score 0.33                GUCUC (   1) MLPS  -4.71 deficit   1.28 prct   0.00 CutScore  86.54;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                CUUCG (   1) MLPS  -5.12 deficit   1.69 prct   0.00 CutScore  82.25;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   1 Score 0.50               UUUUCA (   1) MLPS  -6.91 deficit   3.48 prct   0.00 CutScore  63.40;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   1 Score 0.50               UGGAAA (   1) MLPS  -9.96 deficit   6.52 prct   0.00 CutScore  31.36;  Ed  0, 0 matches the original group, cWW-s35-s55
Group 204 is from HL_61984.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_61984.1
This group is considered to be structured ***************************
Number of NTs:  3  Signature: cWW-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                CUCGG (   1) MLPS  -4.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   1 Score 0.50                CUUUG (   1) MLPS  -4.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Group 219 is from HL_68529.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_68529.1
This group is considered to be structured ***************************
Number of NTs:  3  Signature: cWW-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GAGUCC (   1) MLPS  -3.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00               GAGUCC (   1) MLPS  -3.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00               GAGUCC (   1) MLPS  -3.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   1 Score 0.50               GUGUCC (   1) MLPS  -4.73 deficit   0.85 prct   0.00 CutScore  91.08;  Ed  0, 0 matches the original group, cWW-s35-s55
Group 222 is from HL_69353.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_69353.6
This group is considered to be structured ***************************
Number of NTs:  3  Signature: cWW-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                 CUAG (   1) MLPS  -2.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                 CUAG (   1) MLPS  -2.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                 CUAG (   1) MLPS  -2.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                 CUAG (   1) MLPS  -2.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                 CUAG (   1) MLPS  -2.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   1 Score 0.50                 CUUG (   1) MLPS  -3.56 deficit   0.64 prct   0.00 CutScore  93.31;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   1 Score 0.50                 CUUG (   1) MLPS  -3.56 deficit   0.64 prct   0.00 CutScore  93.31;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                 CAAG (   1) MLPS  -3.66 deficit   0.74 prct   0.00 CutScore  92.24;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                 CAAG (   1) MLPS  -3.66 deficit   0.74 prct   0.00 CutScore  92.24;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   1 Score 0.50                 CUCG (   1) MLPS  -4.14 deficit   1.22 prct   0.00 CutScore  87.12;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                 UUGA (   1) MLPS  -4.20 deficit   1.28 prct   0.00 CutScore  86.48;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                 CGAG (   1) MLPS  -4.45 deficit   1.53 prct   0.00 CutScore  83.94;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                 CAGG (   1) MLPS  -4.55 deficit   1.62 prct   0.00 CutScore  82.90;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                 UAGA (   1) MLPS  -4.94 deficit   2.02 prct   0.00 CutScore  78.71;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                CCAUG (   1) MLPS  -7.87 deficit   4.95 prct   0.00 CutScore  47.94;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                CCGUG (   1) MLPS  -8.75 deficit   5.83 prct   0.00 CutScore  38.60;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00               UUUCUA (   1) MLPS -10.14 deficit   7.22 prct   0.00 CutScore  24.03;  Ed  0, 0 matches the original group, cWW-s35-s55
Group 296 is from HL_96283.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_96283.1
This group is considered to be structured ***************************
Number of NTs:  3  Signature: cWW-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               CUUAUG (   1) MLPS  -4.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Group 305 is from HL_98557.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_98557.4
This group is considered to be structured ***************************
Number of NTs:  3  Signature: cWW-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                CAAAG (   1) MLPS  -3.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                CAUAG (   1) MLPS  -4.22 deficit   0.51 prct   0.00 CutScore  94.62;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                GAUAC (   1) MLPS  -4.35 deficit   0.64 prct   0.00 CutScore  93.22;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                GAUAC (   1) MLPS  -4.35 deficit   0.64 prct   0.00 CutScore  93.22;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                CAGAG (   1) MLPS  -4.81 deficit   1.10 prct   0.00 CutScore  88.44;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   0 Score 1.00                CUCAG (   1) MLPS  -6.11 deficit   2.40 prct   0.00 CutScore  74.76;  Ed  0, 0 matches the original group, cWW-s35-s55
Better:   0 Equal:   4 Score 0.20               CGCGUG (   1) MLPS -10.28 deficit   6.58 prct   0.00 CutScore  30.77;  Ed  0, 0 matches the original group, cWW-s35-s55
Group  36 is from HL_09712.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_09712.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             UUCUGCGG (   1) MLPS  -4.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-F
Group 132 is from HL_40469.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_40469.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-s55-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -4.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-F
Better:   0 Equal:   1 Score 0.50              CGAAUAG (   1) MLPS  -4.96 deficit   0.69 prct   0.00 CutScore  92.70;  Ed  0, 0 matches the original group, cWW-s35-s55-F
Group 194 is from HL_58912.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_58912.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-s55-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               CUGUUG (   1) MLPS  -3.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-F
Group 291 is from HL_94352.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_94352.4
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CUAAGUG (   1) MLPS  -5.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-F-F
Better:   0 Equal:   0 Score 1.00              CUAAGUG (   1) MLPS  -5.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-F-F
Better:   0 Equal:   0 Score 1.00                GAAUC (   1) MLPS  -6.51 deficit   1.47 prct   0.00 CutScore  84.50;  Ed  0, 0 matches the original group, cWW-s35-s55-F-F
Group  48 is from HL_14859.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_14859.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-F-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -4.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-F-F-F
Group  98 is from HL_30596.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_30596.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-F-F-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UCUAUGAUACCA (   1) MLPS  -8.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-F-F-s35-F
Better:   0 Equal:   0 Score 1.00         UCUAUGAUACCA (   1) MLPS  -8.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-F-F-s35-F
Group 196 is from HL_59445.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_59445.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CAAUAGG (   1) MLPS  -5.00 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-F-s35-s35
Group 212 is from HL_67052.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_67052.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-bif-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            ACUCUAAAU (   1) MLPS  -6.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-bif-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GGUAAGUUC (   1) MLPS  -7.62 deficit   1.53 prct   0.00 CutScore  90.67;  Ed  0, 0 matches the original group, cWW-s35-s55-bif-s35-s35-s35-s35-s35
Group 270 is from HL_88858.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_88858.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-bif-s35-tSW-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CCUGAUAAG (   1) MLPS  -6.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-bif-s35-tSW-s55-s35
Group 264 is from HL_86378.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_86378.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-cSH
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UUUCGUGUG (   1) MLPS  -6.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSH
Better:   0 Equal:   0 Score 1.00            UUUCGUGUG (   1) MLPS  -6.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSH
Group 261 is from HL_84050.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_84050.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-cSH-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CCAGUUAG (   1) MLPS  -5.60 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSH-s55
Better:   0 Equal:   0 Score 1.00             CCAGUUAG (   1) MLPS  -5.60 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSH-s55
Group 197 is from HL_59564.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_59564.1
This group is considered to be structured ***************************
Number of NTs: 20  Signature: cWW-s35-s55-cSS-s35-cSS-s35-s35-s35-s35-s35-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50 UGGCCUUUCUUAAAAAAAAA (   1) MLPS -15.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSS-s35-cSS-s35-s35-s35-s35-s35-s35-s35-s35-s35-s35-s35-s35
Group   1 is from HL_00317.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_00317.1
This group is considered to be structured ***************************
Number of NTs: 19  Signature: cWW-s35-s55-cSS-s35-s35-s35-s35-s33-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50 UGGCCUUUCUUAAAAAAAAA (   1) MLPS -15.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSS-s35-s35-s35-s35-s33-s35-s35-s35-s35-s35-s35-s35
Group 243 is from HL_77081.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_77081.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-cSW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              UGAAAAG (   1) MLPS  -4.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSW-s35-s55-s35
Group 280 is from HL_92304.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_92304.3
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-s55-cSW-s35-tSH-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CUUAGAAGCAG (   1) MLPS  -4.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSW-s35-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CUUAGAAGCAG (   1) MLPS  -4.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSW-s35-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CUUAGAAGCAG (   1) MLPS  -4.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSW-s35-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CUUAGAAGCAG (   1) MLPS  -4.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cSW-s35-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CAUGGAAGUCG (   1) MLPS  -9.31 deficit   4.90 prct   0.00 CutScore  76.17;  Ed  0, 0 matches the original group, cWW-s35-s55-cSW-s35-tSH-s35-s35-s35-s35-s35
Group 111 is from HL_33612.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_33612.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-cWH-F-F-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CUUUUGG (   1) MLPS  -4.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWH-F-F-s55
Group  24 is from HL_06137.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_06137.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-s35-s55-cWH-s33-s33-cHW-cWH-s35-cHW-cWH-cWH-s35-cWH-s33-s55-s55-cHW-s33-cWH-s53-s35-s33-cWH-s53-s35-s33-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50 UGUGGAAGGAGUGGCUGGGUUG (   1) MLPS  -9.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWH-s33-s33-cHW-cWH-s35-cHW-cWH-cWH-s35-cWH-s33-s55-s55-cHW-s33-cWH-s53-s35-s33-cWH-s53-s35-s33-s55
Group 239 is from HL_74088.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_74088.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-s35-s55-cWH-s33-s33-cHW-cWH-s53-s35-cHW-cWH-s53-cWH-s35-cWH-s33-tSW-s55-s55-cHW-s33-cWH-s35-s33-cWH-F-s35-s33-s55-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50 UGUGGAAGGAGUGGCUGGGUUG (   1) MLPS  -9.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWH-s33-s33-cHW-cWH-s53-s35-cHW-cWH-s53-cWH-s35-cWH-s33-tSW-s55-s55-cHW-s33-cWH-s35-s33-cWH-F-s35-s33-s55-F
Group  29 is from HL_07432.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_07432.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-cWS-s35-cSH-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CUCAGCAGGUAGAG (   1) MLPS -11.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWS-s35-cSH-s35-s35
Better:   0 Equal:   0 Score 1.00       CUCAGCAGGUAGAG (   1) MLPS -11.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWS-s35-cSH-s35-s35
Group 234 is from HL_72714.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_72714.2
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-cWW-cWH-s53-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UAGGGAACGGGA (   1) MLPS  -7.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-cWH-s53-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00         UAGGGAACGGGA (   1) MLPS  -7.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-cWH-s53-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CUGGAGAUACG (   1) MLPS -10.80 deficit   2.82 prct   0.00 CutScore  85.11;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-cWH-s53-s35-s35-s35-s35-s35-s35-s35
Group 103 is from HL_32255.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_32255.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-s55-cWW-s33-cWW-F-cSS-s53-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UUUUUUAAUG (   1) MLPS  -5.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s33-cWW-F-cSS-s53-s55-s35
Group 136 is from HL_41851.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_41851.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-s55-cWW-s35-s33-s55-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CCUUACGAG (   1) MLPS  -5.55 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s33-s55-s35-s35-s35
Group 275 is from HL_90620.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_90620.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-cWW-s35-s35-cSW-cSH-s53-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          AACCGUAAAAU (   1) MLPS  -7.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s35-cSW-cSH-s53-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          AACCGUAAAAU (   1) MLPS  -7.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s35-cSW-cSH-s53-s35-s35-s35-s35
Group  30 is from HL_07579.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_07579.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-s35-s55-cWW-s35-s35-s35-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     UACUUAUUUCCUUUGA (   1) MLPS  -8.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s35-s35-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00     UACUUAUUUCCUUUGA (   1) MLPS  -8.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s35-s35-s35-s35-s35-s35-s35-s35-s35
Group 253 is from HL_81205.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_81205.2
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-s35-s55-cWW-s35-s35-tWH-s35-tWH-s35-s55-s35-s35-s35-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CACUGAGACACGGG (   1) MLPS  -4.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s35-tWH-s35-tWH-s35-s55-s35-s35-s35-F-F-s35
Better:   0 Equal:   0 Score 1.00       CACUGAGACACGGG (   1) MLPS  -4.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s35-tWH-s35-tWH-s35-s55-s35-s35-s35-F-F-s35
Better:   0 Equal:   0 Score 1.00       AACUGAGACACGGU (   1) MLPS  -5.42 deficit   0.53 prct   0.00 CutScore  97.40;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s35-tWH-s35-tWH-s35-s55-s35-s35-s35-F-F-s35
Group 262 is from HL_85984.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_85984.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-s35-s55-cWW-s35-s55-cWW-s35-s35-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UUUCAGAGAUGAGA (   1) MLPS -10.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-cWW-s35-s35-F-s35-s35
Group  16 is from HL_04171.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_04171.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-s55-cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          AUGAUAUGGUU (   1) MLPS  -7.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Better:   0 Equal:   0 Score 1.00          AUGAUAUGGUU (   1) MLPS  -7.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Better:   0 Equal:   0 Score 1.00          AUGAUAUGGUU (   1) MLPS  -7.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Better:   0 Equal:   0 Score 1.00          AUGAUAUGGUU (   1) MLPS  -7.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Better:   0 Equal:   0 Score 1.00          AUGAUAUGGUU (   1) MLPS  -7.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Better:   0 Equal:   0 Score 1.00          UUACCGUAGUA (   1) MLPS  -7.97 deficit   0.96 prct   0.00 CutScore  94.75;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Better:   0 Equal:   0 Score 1.00          UUACCGUAGUA (   1) MLPS  -7.97 deficit   0.96 prct   0.00 CutScore  94.75;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Better:   0 Equal:   0 Score 1.00          UUACCGUAGUA (   1) MLPS  -7.97 deficit   0.96 prct   0.00 CutScore  94.75;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Better:   0 Equal:   0 Score 1.00         GUAGUGGUAAUC (   1) MLPS -14.07 deficit   7.06 prct   0.00 CutScore  61.38;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Group 258 is from HL_82866.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_82866.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-s35-s55-cWW-s35-s55-tWW-s35-s35-s35-s33-s35-s35-s35-s35-s35-s35-s33-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    CAACUUAGGAUUUUAGG (   1) MLPS -11.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-s55-tWW-s35-s35-s35-s33-s35-s35-s35-s35-s35-s35-s33-s55-s35
Group 112 is from HL_34135.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_34135.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-cWW-s35-tSH-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UUUUUGAUA (   1) MLPS  -6.60 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-cWW-s35-tSH-s35-s35-s35
Group  73 is from HL_22515.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_22515.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-s33-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-F
Group 148 is from HL_44911.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_44911.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-s33-F-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50             AGGCAAUU (   1) MLPS  -5.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-F-F-F
Group 117 is from HL_35888.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_35888.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-s33-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50             AGGCAAUU (   1) MLPS  -5.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-F-s35-s35
Group 209 is from HL_66171.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_66171.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-s33-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CGACACAG (   1) MLPS  -3.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00             CGACACAG (   1) MLPS  -3.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00             CGACACAG (   1) MLPS  -3.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00             CGACACAG (   1) MLPS  -3.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00             CGCAGCAG (   1) MLPS  -6.41 deficit   3.30 prct   0.00 CutScore  77.51;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Group 247 is from HL_79272.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_79272.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-s33-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                CGCAG (   1) MLPS  -3.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00                CGCAG (   1) MLPS  -3.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00                CGCAG (   1) MLPS  -3.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00                CGCAG (   1) MLPS  -3.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00                CGAAG (   1) MLPS  -3.55 deficit   0.37 prct   0.00 CutScore  96.13;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00                CGAAG (   1) MLPS  -3.55 deficit   0.37 prct   0.00 CutScore  96.13;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00                CGAAG (   1) MLPS  -3.55 deficit   0.37 prct   0.00 CutScore  96.13;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -5.85 deficit   2.67 prct   0.00 CutScore  71.89;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00               CUCUUG (   1) MLPS  -6.13 deficit   2.95 prct   0.00 CutScore  68.98;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   0 Score 1.00               CUCUUG (   1) MLPS  -6.13 deficit   2.95 prct   0.00 CutScore  68.98;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Better:   0 Equal:   1 Score 0.50               CUGUUG (   1) MLPS  -7.59 deficit   4.41 prct   0.00 CutScore  53.55;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35
Group 233 is from HL_72451.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_72451.4
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-s33-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGAACAAC (   1) MLPS  -2.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35-s35
Better:   0 Equal:   0 Score 1.00             GGAACAAC (   1) MLPS  -2.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35-s35
Better:   0 Equal:   0 Score 1.00             GAAACAAC (   1) MLPS  -2.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35-s35
Better:   0 Equal:   0 Score 1.00             GAAACAAC (   1) MLPS  -2.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35-s35
Better:   0 Equal:   0 Score 1.00             GAAACAGC (   1) MLPS  -4.00 deficit   1.30 prct   0.00 CutScore  88.15;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35-s35
Better:   0 Equal:   0 Score 1.00             GGAUGAAC (   1) MLPS  -5.56 deficit   2.85 prct   0.00 CutScore  73.97;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35-s35
Group  50 is from HL_15968.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_15968.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-s33-s35-s53-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   3 Score 0.25           CAGUCGGUAG (   1) MLPS  -4.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35-s53-F
Better:   0 Equal:   3 Score 0.25           CAGUCGGUAG (   1) MLPS  -4.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s35-s53-F
Group  91 is from HL_27757.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_27757.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-s33-s55-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CGGAAAGG (   1) MLPS  -4.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s55-F
Group 158 is from HL_48962.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_48962.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-s55-s33-s55-s35-s35-s53
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CAAAAAUGAAG (   1) MLPS  -7.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s33-s55-s35-s35-s53
Group 145 is from HL_44730.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_44730.2
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               CCUUGG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Better:   0 Equal:   0 Score 1.00               CCUUGG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Better:   0 Equal:   0 Score 1.00              UUCGGGA (   1) MLPS  -6.84 deficit   1.27 prct   0.00 CutScore  86.66;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Better:   0 Equal:   0 Score 1.00              UAGUGUA (   1) MLPS  -7.58 deficit   2.00 prct   0.00 CutScore  78.92;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Group 166 is from HL_50374.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_50374.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UAAUUCA (   1) MLPS  -5.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Group 173 is from HL_52240.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_52240.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               AAAUUU (   1) MLPS  -4.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Group 206 is from HL_62869.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_62869.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Better:   0 Equal:   1 Score 0.50               GGGAAC (   1) MLPS  -3.48 deficit   0.85 prct   0.00 CutScore  91.08;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Group 227 is from HL_69941.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_69941.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   4 Score 0.20               CGCGUG (   1) MLPS  -5.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Better:   0 Equal:   0 Score 1.00               ACCUAU (   1) MLPS  -5.33 deficit   0.00 prct   0.00 CutScore  99.99;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Group 259 is from HL_83225.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_83225.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CGUAUUG (   1) MLPS  -4.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Group 298 is from HL_96487.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_96487.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CAUGUAG (   1) MLPS  -6.62 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35
Group   3 is from HL_01008.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_01008.4
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GAUCAC (   1) MLPS  -2.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F
Better:   0 Equal:   0 Score 1.00               GAUCAC (   1) MLPS  -2.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F
Better:   0 Equal:   0 Score 1.00               GAUCAC (   1) MLPS  -2.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F
Better:   0 Equal:   0 Score 1.00               GAUCAC (   1) MLPS  -2.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F
Better:   0 Equal:   0 Score 1.00               CAACAG (   1) MLPS  -3.46 deficit   0.74 prct   0.00 CutScore  92.76;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F
Better:   0 Equal:   0 Score 1.00               CAACAG (   1) MLPS  -3.46 deficit   0.74 prct   0.00 CutScore  92.76;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F
Better:   0 Equal:   0 Score 1.00               GAUUAC (   1) MLPS  -3.95 deficit   1.23 prct   0.00 CutScore  88.07;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F
Better:   0 Equal:   0 Score 1.00               GAUUAC (   1) MLPS  -3.95 deficit   1.23 prct   0.00 CutScore  88.07;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F
Better:   0 Equal:   1 Score 0.50               CUACGG (   1) MLPS  -6.93 deficit   4.21 prct   0.00 CutScore  59.04;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F
Group 256 is from HL_82678.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_82678.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-s35-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               CAUUUG (   1) MLPS  -4.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F-F
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F-F
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F-F
Better:   0 Equal:   0 Score 1.00              CAUGUGG (   1) MLPS  -6.11 deficit   1.15 prct   0.00 CutScore  87.89;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F-F
Better:   0 Equal:   0 Score 1.00              CAUGUGG (   1) MLPS  -6.11 deficit   1.15 prct   0.00 CutScore  87.89;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F-F
Better:   0 Equal:   4 Score 0.20               CGCGUG (   1) MLPS  -6.26 deficit   1.30 prct   0.00 CutScore  86.32;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F-F
Group 293 is from HL_94607.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_94607.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-s35-F-s53
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GGCUCAUAACC (   1) MLPS  -9.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F-s53
Group 236 is from HL_73235.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_73235.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-s35-F-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CAGCACUUUG (   1) MLPS  -7.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-F-s55
Group 265 is from HL_86769.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_86769.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-s35-cSS-s35-cSH-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             AGGGUCAU (   1) MLPS  -7.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-cSH-s55
Better:   0 Equal:   0 Score 1.00             AGGGUCAU (   1) MLPS  -7.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-cSH-s55
Better:   0 Equal:   0 Score 1.00             CACCUCAG (   1) MLPS  -7.63 deficit   0.14 prct   0.00 CutScore  98.78;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-cSH-s55
Better:   0 Equal:   0 Score 1.00             GACGAUAU (   1) MLPS  -8.82 deficit   1.34 prct   0.00 CutScore  88.43;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-cSH-s55
Group  23 is from HL_06048.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_06048.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CAAGAAAGAG (   1) MLPS  -7.91 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Better:   0 Equal:   0 Score 1.00           CAAGAAAGAG (   1) MLPS  -7.91 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-cSS-s55-s35-s35
Group  68 is from HL_20743.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_20743.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-s35-cSS-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GGAUAUGGC (   1) MLPS  -5.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-s55-s35
Better:   0 Equal:   0 Score 1.00            GGAUAUGGC (   1) MLPS  -5.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-s55-s35
Better:   0 Equal:   0 Score 1.00            GGAUAUGGC (   1) MLPS  -5.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-s55-s35
Better:   0 Equal:   0 Score 1.00            GGAUAUAGC (   1) MLPS  -5.68 deficit   0.32 prct   0.00 CutScore  97.85;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-s55-s35
Better:   0 Equal:   0 Score 1.00            AAAUAUGGU (   1) MLPS  -5.77 deficit   0.40 prct   0.00 CutScore  97.27;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-s55-s35
Better:   0 Equal:   0 Score 1.00            CAUAAUGGG (   1) MLPS  -6.59 deficit   1.22 prct   0.00 CutScore  91.68;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-s55-s35
Better:   0 Equal:   0 Score 1.00            CAUAAUGGG (   1) MLPS  -6.59 deficit   1.22 prct   0.00 CutScore  91.68;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cSS-s35-s55-s35
Group 104 is from HL_32458.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_32458.2
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-s55-s35-cWW-s33-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GGUUCGAAUCC (   1) MLPS  -8.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GGUUCGAUUCC (   1) MLPS  -8.52 deficit   0.51 prct   0.00 CutScore  97.21;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cWW-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CAACUCUACCG (   1) MLPS -12.26 deficit   4.25 prct   0.00 CutScore  76.77;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-cWW-s33-s35-s35-s35
Group  83 is from HL_25466.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_25466.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-s35-s33-F-s35-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -7.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s33-F-s35-F-F
Better:   0 Equal:   1 Score 0.50         CAUUGCACCUCG (   1) MLPS  -7.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s33-F-s35-F-F
Group 300 is from HL_96854.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_96854.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-s55-s35-s33-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GACUCAACAC (   1) MLPS  -7.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s33-s35
Group 271 is from HL_88982.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_88982.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-s35-s33-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CAAAAUAACAAG (   1) MLPS  -6.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s33-s35-s35
Better:   0 Equal:   0 Score 1.00         CAAAAUAACAAG (   1) MLPS  -6.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s33-s35-s35
Group  39 is from HL_11805.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_11805.2
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-s35-s33-s53-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GGACGGAAAUC (   1) MLPS  -5.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s33-s53-F-s35-s35
Better:   0 Equal:   0 Score 1.00          GGUUGGAAAUC (   1) MLPS  -5.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s33-s53-F-s35-s35
Better:   0 Equal:   0 Score 1.00          GGUCGGACAUC (   1) MLPS  -5.82 deficit   0.14 prct   0.00 CutScore  99.26;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s33-s53-F-s35-s35
Group  10 is from HL_02733.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_02733.4
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CAUGCCG (   1) MLPS  -2.52 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00              CAUGCCG (   1) MLPS  -2.52 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00              CAUGCCG (   1) MLPS  -2.52 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00              CAUGCCG (   1) MLPS  -2.52 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00              CAUUCCG (   1) MLPS  -3.62 deficit   1.10 prct   0.00 CutScore  92.23;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00              CAUCCCG (   1) MLPS  -3.62 deficit   1.10 prct   0.00 CutScore  92.23;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00               CGUCCG (   1) MLPS  -5.41 deficit   2.89 prct   0.00 CutScore  79.58;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Group  42 is from HL_12703.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_12703.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00                GGCCC (   1) MLPS  -4.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00                GGCCC (   1) MLPS  -4.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             CAUUUUGG (   1) MLPS  -9.01 deficit   4.58 prct   0.00 CutScore  51.80;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Group  93 is from HL_28567.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_28567.3
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -5.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -5.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00               GAGUAC (   1) MLPS  -5.97 deficit   0.92 prct   0.00 CutScore  90.27;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00               CGAGUG (   1) MLPS  -6.14 deficit   1.10 prct   0.00 CutScore  88.44;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             CCAAAUAG (   1) MLPS  -7.98 deficit   2.94 prct   0.00 CutScore  69.06;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00              CAGAGCG (   1) MLPS  -8.77 deficit   3.73 prct   0.00 CutScore  60.77;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35
Group  92 is from HL_28085.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_28085.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-s35-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CAGUAAAUG (   1) MLPS  -6.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-F
Group  86 is from HL_26501.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_26501.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-s35-s35-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CAGCUACUCG (   1) MLPS  -7.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-F-F
Group 260 is from HL_83704.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_83704.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-s35-s35-cSS-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGUGAAUGAC (   1) MLPS  -8.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-cSS-s35-F
Group 159 is from HL_49194.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_49194.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGACGAUC (   1) MLPS  -4.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35
Group 302 is from HL_97733.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_97733.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-s35-s35-s35-cSH-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CCCGGUCAGG (   1) MLPS  -8.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-cSH-s55
Group  97 is from HL_30585.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_30585.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-s35-s55-s35-s35-s35-cSS-s35-cSW-s35-s55-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    AGUCGCGUGAUAAAUGU (   1) MLPS -12.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-cSS-s35-cSW-s35-s55-s35-s35-s35-s35-s35
Group 130 is from HL_38646.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_38646.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGUAAUGC (   1) MLPS  -4.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50             GAUAAUGC (   1) MLPS  -4.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-s35
Group 221 is from HL_68863.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_68863.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-s35-s35-s35-s35-s35-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        AGGUGGGGUUUAU (   1) MLPS  -9.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-s35-s35-s35-F
Group 288 is from HL_93650.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_93650.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-s35-s55-s35-s35-s35-s35-s35-s35-s35-tWH-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CAUCCGAGUUGCAAG (   1) MLPS  -7.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-s35-s35-s35-s35-tWH-s35-s55-s35
Better:   0 Equal:   0 Score 1.00      CAUCCGAGUUGCAAG (   1) MLPS  -7.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-s35-s35-s35-s35-tWH-s35-s55-s35
Group 263 is from HL_86109.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_86109.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-s35-s55-s35-s35-s35-s35-tWH-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGGCGGUGGGAGC (   1) MLPS  -6.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-s35-tWH-s35-s55-s35
Better:   0 Equal:   0 Score 1.00        GGGCGGUGGGAGC (   1) MLPS  -6.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-s35-tWH-s35-s55-s35
Better:   0 Equal:   0 Score 1.00        GGAUAGUGAAAGC (   1) MLPS  -9.44 deficit   2.70 prct   0.00 CutScore  86.49;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-s35-tWH-s35-s55-s35
Group  28 is from HL_07268.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_07268.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-s35-s35-s35-s53-s53-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CAAUUUAUACAG (   1) MLPS  -8.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s35-s53-s53-s35-s35
Group 137 is from HL_42211.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_42211.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-s35-s55-s35-s35-s55-F-F-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UGGAAUUGGUAGACA (   1) MLPS -10.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s55-F-F-F-F-s35
Group   5 is from HL_01187.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_01187.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-s35-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GAAUUAAC (   1) MLPS  -5.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s55-s35
Group 170 is from HL_51033.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_51033.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-s35-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GGUCUC (   1) MLPS  -5.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s55-s35
Better:   0 Equal:   0 Score 1.00             AACCUAUU (   1) MLPS  -7.16 deficit   1.96 prct   0.00 CutScore  79.36;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s35-s55-s35
Group 177 is from HL_53189.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_53189.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-s35-s53
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50                CUCUG (   1) MLPS  -3.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s53
Group 102 is from HL_31581.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_31581.4
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -5.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -5.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -5.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -5.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35
Group 119 is from HL_35978.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_35978.6
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-s35-s55-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -3.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -3.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -3.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -3.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -3.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -3.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -3.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -3.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -3.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   2 Score 0.33         CAUUGCACUCCG (   1) MLPS  -3.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50         CAUUGCACCUCG (   1) MLPS  -7.21 deficit   3.98 prct   0.00 CutScore  82.16;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        UAUUGCAGUACCG (   1) MLPS -11.28 deficit   8.05 prct   0.00 CutScore  63.94;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-s55-s35-s35-s35
Group 268 is from HL_87219.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_87219.4
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CGGUGAAAUG (   1) MLPS  -7.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           CGGUGAAAUG (   1) MLPS  -7.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           CGGUGAAAUG (   1) MLPS  -7.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           AGGUGAAAUU (   1) MLPS  -7.59 deficit   0.05 prct   0.00 CutScore  99.67;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GAUUAGAUACC (   1) MLPS  -8.60 deficit   1.07 prct   0.00 CutScore  93.19;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GAUUAGAUACC (   1) MLPS  -8.60 deficit   1.07 prct   0.00 CutScore  93.19;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GAUUAGAUACC (   1) MLPS  -8.60 deficit   1.07 prct   0.00 CutScore  93.19;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GAUCAGAUACC (   1) MLPS -10.74 deficit   3.20 prct   0.00 CutScore  79.56;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           AGGGGAACCU (   1) MLPS -11.39 deficit   3.85 prct   0.00 CutScore  75.42;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           GUGUAACAAC (   1) MLPS -11.92 deficit   4.38 prct   0.00 CutScore  72.04;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          GGUUCAAGUCC (   1) MLPS -12.10 deficit   4.56 prct   0.00 CutScore  70.92;  Ed  0, 0 matches the original group, cWW-s35-s55-s35-tSH-s35-s35-s35-s35-s35-s35
Group 205 is from HL_62604.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_62604.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-s53-s53-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -6.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s53-s53-s35
Better:   0 Equal:   0 Score 1.00              UUUGCGA (   1) MLPS  -6.84 deficit   0.69 prct   0.00 CutScore  92.70;  Ed  0, 0 matches the original group, cWW-s35-s55-s53-s53-s35
Group  74 is from HL_22576.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_22576.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-s55-s55-F-s55-s35-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CCUAAUUAGUGG (   1) MLPS  -8.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-s55-F-s55-s35-F-s35
Group  62 is from HL_19162.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_19162.2
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-s35-s55-tSH-F-F-s35-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GGAACACUAUAC (   1) MLPS  -8.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-F-F-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00         GGAACACUAUAC (   1) MLPS  -8.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-F-F-s35-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00         CGGCGCAUGCAG (   1) MLPS -12.17 deficit   3.63 prct   0.00 CutScore  79.80;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-F-F-s35-s35-s35-s35-s35-s35-s35
Group 164 is from HL_49873.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_49873.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-tSH-cWS-s35-cWS-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGAAUGGGUAGAC (   1) MLPS  -8.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-cWS-s35-cWS-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        GGAAUCGGUAGAC (   1) MLPS  -9.38 deficit   1.10 prct   0.00 CutScore  93.74;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-cWS-s35-cWS-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        GAAAUCGGUAAAC (   1) MLPS -11.05 deficit   2.78 prct   0.00 CutScore  84.17;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-cWS-s35-cWS-s35-s35-s35
Group  75 is from HL_23090.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_23090.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-tSH-s33-s33-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CGACAUAAG (   1) MLPS  -5.62 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s33-s35-s35-s35-s35
Group 274 is from HL_90257.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_90257.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-s35-s55-tSH-s33-s33-s55-s35-s35-s35-s35-s35-F-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   CGAAAAAAUUGGAAGUAG (   1) MLPS -11.46 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s33-s55-s35-s35-s35-s35-s35-F-F-s35-s35
Group 306 is from HL_98870.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_98870.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-s35-s55-tSH-s33-s33-s55-s55-tWW-s35-F-s35-s53-s55-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UGUGGUACAGAGAAG (   1) MLPS  -7.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s33-s55-s55-tWW-s35-F-s35-s53-s55-s35-s35
Better:   0 Equal:   0 Score 1.00    CGUAGGCUACAGAGAAG (   1) MLPS -11.61 deficit   3.68 prct   0.00 CutScore  82.19;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s33-s55-s55-tWW-s35-F-s35-s53-s55-s35-s35
Group  94 is from HL_28843.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_28843.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-s35-s55-tSH-s33-s33-s55-tHW-s35-s35-s35-s35-s35-s35-s35-s35-cSH-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UGAAGGCAGAAGUAA (   1) MLPS -14.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s33-s55-tHW-s35-s35-s35-s35-s35-s35-s35-s35-cSH-s35-s35
Group 140 is from HL_43074.14 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_43074.14
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-tSH-s33-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -1.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -2.58 deficit   0.82 prct   0.00 CutScore  91.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -3.04 deficit   1.28 prct   0.00 CutScore  86.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               AGAAAU (   1) MLPS  -3.30 deficit   1.55 prct   0.00 CutScore  83.95;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               AGAAAU (   1) MLPS  -3.30 deficit   1.55 prct   0.00 CutScore  83.95;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               AGAAAU (   1) MLPS  -3.30 deficit   1.55 prct   0.00 CutScore  83.95;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               AGAAAU (   1) MLPS  -3.30 deficit   1.55 prct   0.00 CutScore  83.95;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               AGAAAU (   1) MLPS  -3.30 deficit   1.55 prct   0.00 CutScore  83.95;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               AGAAAU (   1) MLPS  -3.30 deficit   1.55 prct   0.00 CutScore  83.95;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               AGAAAU (   1) MLPS  -3.30 deficit   1.55 prct   0.00 CutScore  83.95;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               AGAAAU (   1) MLPS  -3.30 deficit   1.55 prct   0.00 CutScore  83.95;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               AGAAAU (   1) MLPS  -3.30 deficit   1.55 prct   0.00 CutScore  83.95;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -3.36 deficit   1.60 prct   0.00 CutScore  83.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUAAG (   1) MLPS  -3.39 deficit   1.63 prct   0.00 CutScore  83.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUAAG (   1) MLPS  -3.39 deficit   1.63 prct   0.00 CutScore  83.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUAAG (   1) MLPS  -3.39 deficit   1.63 prct   0.00 CutScore  83.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUAAG (   1) MLPS  -3.39 deficit   1.63 prct   0.00 CutScore  83.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUAAG (   1) MLPS  -3.39 deficit   1.63 prct   0.00 CutScore  83.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUAAG (   1) MLPS  -3.39 deficit   1.63 prct   0.00 CutScore  83.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.46 deficit   1.71 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.46 deficit   1.71 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.46 deficit   1.71 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.46 deficit   1.71 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.46 deficit   1.71 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.46 deficit   1.71 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.46 deficit   1.71 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.46 deficit   1.71 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.46 deficit   1.71 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               UGAAAA (   1) MLPS  -3.46 deficit   1.71 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAAAG (   1) MLPS  -3.63 deficit   1.88 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGAGAC (   1) MLPS  -3.86 deficit   2.10 prct   0.00 CutScore  78.18;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGAGAC (   1) MLPS  -3.86 deficit   2.10 prct   0.00 CutScore  78.18;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGCAAC (   1) MLPS  -4.18 deficit   2.43 prct   0.00 CutScore  74.83;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGCAAC (   1) MLPS  -4.18 deficit   2.43 prct   0.00 CutScore  74.83;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGUAAC (   1) MLPS  -4.21 deficit   2.46 prct   0.00 CutScore  74.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGUAAC (   1) MLPS  -4.21 deficit   2.46 prct   0.00 CutScore  74.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGUAAC (   1) MLPS  -4.21 deficit   2.46 prct   0.00 CutScore  74.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGUAAC (   1) MLPS  -4.21 deficit   2.46 prct   0.00 CutScore  74.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGGAAG (   1) MLPS  -4.31 deficit   2.55 prct   0.00 CutScore  73.52;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGGAAG (   1) MLPS  -4.31 deficit   2.55 prct   0.00 CutScore  73.52;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGGAAG (   1) MLPS  -4.31 deficit   2.55 prct   0.00 CutScore  73.52;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGGAAG (   1) MLPS  -4.31 deficit   2.55 prct   0.00 CutScore  73.52;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGAAGG (   1) MLPS  -4.60 deficit   2.85 prct   0.00 CutScore  70.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGAAGG (   1) MLPS  -4.60 deficit   2.85 prct   0.00 CutScore  70.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGAAGG (   1) MLPS  -4.60 deficit   2.85 prct   0.00 CutScore  70.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGAAGG (   1) MLPS  -4.60 deficit   2.85 prct   0.00 CutScore  70.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGAAGG (   1) MLPS  -4.60 deficit   2.85 prct   0.00 CutScore  70.46;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGCGAG (   1) MLPS  -4.64 deficit   2.88 prct   0.00 CutScore  70.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGCGAG (   1) MLPS  -4.64 deficit   2.88 prct   0.00 CutScore  70.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGCGAG (   1) MLPS  -4.64 deficit   2.88 prct   0.00 CutScore  70.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGCGAG (   1) MLPS  -4.64 deficit   2.88 prct   0.00 CutScore  70.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGCGAG (   1) MLPS  -4.64 deficit   2.88 prct   0.00 CutScore  70.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGCGAG (   1) MLPS  -4.64 deficit   2.88 prct   0.00 CutScore  70.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -4.67 deficit   2.91 prct   0.00 CutScore  69.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAGAA (   1) MLPS  -4.74 deficit   2.99 prct   0.00 CutScore  69.04;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CUAACG (   1) MLPS  -4.89 deficit   3.13 prct   0.00 CutScore  67.52;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CUAACG (   1) MLPS  -4.89 deficit   3.13 prct   0.00 CutScore  67.52;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CUAACG (   1) MLPS  -4.89 deficit   3.13 prct   0.00 CutScore  67.52;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CUAACG (   1) MLPS  -4.89 deficit   3.13 prct   0.00 CutScore  67.52;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               AGCAAU (   1) MLPS  -4.91 deficit   3.15 prct   0.00 CutScore  67.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAGAG (   1) MLPS  -4.91 deficit   3.16 prct   0.00 CutScore  67.23;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAGAG (   1) MLPS  -4.91 deficit   3.16 prct   0.00 CutScore  67.23;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGAGAG (   1) MLPS  -4.91 deficit   3.16 prct   0.00 CutScore  67.23;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGCAAG (   1) MLPS  -5.24 deficit   3.48 prct   0.00 CutScore  63.88;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGCAAG (   1) MLPS  -5.24 deficit   3.48 prct   0.00 CutScore  63.88;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CAAACG (   1) MLPS  -5.30 deficit   3.55 prct   0.00 CutScore  63.21;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               GGCGAC (   1) MLPS  -5.46 deficit   3.71 prct   0.00 CutScore  61.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               GGCGAC (   1) MLPS  -5.46 deficit   3.71 prct   0.00 CutScore  61.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               GGCGAC (   1) MLPS  -5.46 deficit   3.71 prct   0.00 CutScore  61.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGACAG (   1) MLPS  -5.47 deficit   3.71 prct   0.00 CutScore  61.50;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGUGAC (   1) MLPS  -5.49 deficit   3.74 prct   0.00 CutScore  61.27;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGUGAC (   1) MLPS  -5.49 deficit   3.74 prct   0.00 CutScore  61.27;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGUGAC (   1) MLPS  -5.49 deficit   3.74 prct   0.00 CutScore  61.27;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGGGAG (   1) MLPS  -5.59 deficit   3.83 prct   0.00 CutScore  60.24;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGGGAG (   1) MLPS  -5.59 deficit   3.83 prct   0.00 CutScore  60.24;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGGGAG (   1) MLPS  -5.59 deficit   3.83 prct   0.00 CutScore  60.24;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CCAAAG (   1) MLPS  -5.62 deficit   3.87 prct   0.00 CutScore  59.89;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               AGCGAU (   1) MLPS  -6.19 deficit   4.43 prct   0.00 CutScore  54.05;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CGCAGG (   1) MLPS  -6.21 deficit   4.45 prct   0.00 CutScore  53.83;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               AGUGAU (   1) MLPS  -6.21 deficit   4.46 prct   0.00 CutScore  53.77;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               AGUGAU (   1) MLPS  -6.21 deficit   4.46 prct   0.00 CutScore  53.77;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               AGUGAU (   1) MLPS  -6.21 deficit   4.46 prct   0.00 CutScore  53.77;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGUAGG (   1) MLPS  -6.24 deficit   4.48 prct   0.00 CutScore  53.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              CGAAAUG (   1) MLPS  -6.25 deficit   4.50 prct   0.00 CutScore  53.38;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGUGAA (   1) MLPS  -6.37 deficit   4.62 prct   0.00 CutScore  52.13;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGUGAA (   1) MLPS  -6.37 deficit   4.62 prct   0.00 CutScore  52.13;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CUCACG (   1) MLPS  -6.49 deficit   4.74 prct   0.00 CutScore  50.89;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGUGAG (   1) MLPS  -6.55 deficit   4.79 prct   0.00 CutScore  50.32;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               AAAAAU (   1) MLPS  -6.96 deficit   5.21 prct   0.00 CutScore  46.01;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               AAAAAU (   1) MLPS  -6.96 deficit   5.21 prct   0.00 CutScore  46.01;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   1 Score 0.50               CGAACG (   1) MLPS  -7.02 deficit   5.27 prct   0.00 CutScore  45.38;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              AGAAAGU (   1) MLPS  -7.55 deficit   5.79 prct   0.00 CutScore  39.94;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CUGAAG (   1) MLPS  -7.81 deficit   6.05 prct   0.00 CutScore  37.26;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGGAGC (   1) MLPS  -7.98 deficit   6.23 prct   0.00 CutScore  35.43;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGGAGC (   1) MLPS  -7.98 deficit   6.23 prct   0.00 CutScore  35.43;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GGGAGC (   1) MLPS  -7.98 deficit   6.23 prct   0.00 CutScore  35.43;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UUAGCG (   1) MLPS  -8.05 deficit   6.29 prct   0.00 CutScore  34.75;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UUAGCG (   1) MLPS  -8.05 deficit   6.29 prct   0.00 CutScore  34.75;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GGUAAGC (   1) MLPS  -8.46 deficit   6.70 prct   0.00 CutScore  30.53;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GGUAAGC (   1) MLPS  -8.46 deficit   6.70 prct   0.00 CutScore  30.53;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GUGAAC (   1) MLPS  -8.63 deficit   6.88 prct   0.00 CutScore  28.71;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UUCAAG (   1) MLPS  -8.74 deficit   6.98 prct   0.00 CutScore  27.62;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              CGGAACG (   1) MLPS  -8.81 deficit   7.05 prct   0.00 CutScore  26.90;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGACGG (   1) MLPS -10.20 deficit   8.44 prct   0.00 CutScore  12.47;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               GAAGCU (   1) MLPS -10.46 deficit   8.70 prct   0.00 CutScore   9.79;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GCAACUC (   1) MLPS -10.91 deficit   9.15 prct   0.00 CutScore   5.09;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CGAUAACG (   1) MLPS -11.09 deficit   9.34 prct   0.00 CutScore   3.20;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               CAGCCG (   1) MLPS -11.57 deficit   9.82 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS -11.95 deficit  10.20 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS -11.95 deficit  10.20 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GUAAUUC (   1) MLPS -12.60 deficit  10.84 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             UGAUAAGG (   1) MLPS -12.72 deficit  10.97 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             AGCUAACU (   1) MLPS -14.24 deficit  12.49 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               ACCUUU (   1) MLPS -15.67 deficit  13.92 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35
Group 297 is from HL_96423.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_96423.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-s55-tSH-s33-s35-s35-s35-s35-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50         UAUCGGUUAGAG (   1) MLPS  -8.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35-s35-F-s35
Group 155 is from HL_48376.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_48376.3
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-s55-tSH-s33-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CGUGUGGAAG (   1) MLPS  -7.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           CGUGUGGAAG (   1) MLPS  -7.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           CGCAUGGAAG (   1) MLPS  -7.99 deficit   0.67 prct   0.00 CutScore  95.38;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UGAAUGGAAG (   1) MLPS  -8.53 deficit   1.21 prct   0.00 CutScore  91.73;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50         UAUCGGUUAGAG (   1) MLPS -16.56 deficit   9.24 prct   0.00 CutScore  36.62;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-s35-s35-s35-s35-s35
Group 174 is from HL_52657.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_52657.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-s35-s55-tSH-s33-s35-tSH-s33-s55-bif-s35-s35-s35-F-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    CGGAUCAGUCACCCAAG (   1) MLPS -11.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-s35-tSH-s33-s55-bif-s35-s35-s35-F-s35-s35-s35-s35-s35
Group  65 is from HL_19870.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_19870.4
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-tSH-s33-tHH-s53-s53-tWW-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CUAAAAGGUAACG (   1) MLPS  -7.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-tHH-s53-s53-tWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        CUAAAAGGUAACG (   1) MLPS  -7.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-tHH-s53-s53-tWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        CGAAAAGAUAUCG (   1) MLPS  -8.16 deficit   0.97 prct   0.00 CutScore  95.15;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-tHH-s53-s53-tWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        CCAAAAUGUAACG (   1) MLPS  -8.70 deficit   1.51 prct   0.00 CutScore  92.43;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-tHH-s53-s53-tWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        CUAAAGAGUAACG (   1) MLPS  -9.39 deficit   2.20 prct   0.00 CutScore  89.01;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-tHH-s53-s53-tWW-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00        UUAAACGAUAACG (   1) MLPS  -9.85 deficit   2.66 prct   0.00 CutScore  86.71;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s33-tHH-s53-s53-tWW-s35-s35-s35-s35-s35
Group  84 is from HL_25660.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_25660.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-tSH-s35-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              CGAAUAG (   1) MLPS  -5.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-F-s35
Group 106 is from HL_32527.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_32527.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-tSH-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   6 Score 0.14               GGAAAC (   1) MLPS  -3.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35
Better:   0 Equal:   2 Score 0.33               CGAAAG (   1) MLPS  -3.70 deficit   0.05 prct   0.00 CutScore  99.44;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35
Better:   0 Equal:   0 Score 1.00              GGAACAC (   1) MLPS  -5.25 deficit   1.60 prct   0.00 CutScore  83.13;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35
Group  17 is from HL_04891.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_04891.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-tSH-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33               CGAGAG (   1) MLPS  -5.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GGAGGAC (   1) MLPS  -5.77 deficit   0.69 prct   0.00 CutScore  92.70;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35
Group 216 is from HL_68304.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_68304.6
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-tSH-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               CGGAAG (   1) MLPS  -6.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              CGACGAG (   1) MLPS  -6.46 deficit   0.44 prct   0.00 CutScore  95.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              CGACGAG (   1) MLPS  -6.46 deficit   0.44 prct   0.00 CutScore  95.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35
Better:   0 Equal:   1 Score 0.50              CGGCGAG (   1) MLPS  -6.46 deficit   0.44 prct   0.00 CutScore  95.37;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUAAG (   1) MLPS  -6.86 deficit   0.85 prct   0.00 CutScore  91.08;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              UGAUAAA (   1) MLPS  -7.17 deficit   1.16 prct   0.00 CutScore  87.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGGAGG (   1) MLPS  -8.09 deficit   2.08 prct   0.00 CutScore  78.12;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              UGCAUAA (   1) MLPS  -9.12 deficit   3.10 prct   0.00 CutScore  67.33;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35
Group 289 is from HL_93727.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_93727.3
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-tSH-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGUAACAC (   1) MLPS  -5.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CGUAACAG (   1) MLPS  -5.88 deficit   0.10 prct   0.00 CutScore  99.07;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CGUAACAG (   1) MLPS  -5.88 deficit   0.10 prct   0.00 CutScore  99.07;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CGUAAUAG (   1) MLPS  -6.15 deficit   0.37 prct   0.00 CutScore  96.54;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CGUAAUAG (   1) MLPS  -6.15 deficit   0.37 prct   0.00 CutScore  96.54;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50             GUUAAAAC (   1) MLPS  -6.56 deficit   0.78 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GGUAACGGC (   1) MLPS  -6.91 deficit   1.13 prct   0.00 CutScore  89.34;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GGUAAUGGC (   1) MLPS  -7.18 deficit   1.40 prct   0.00 CutScore  86.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GGUAAUGGC (   1) MLPS  -7.18 deficit   1.40 prct   0.00 CutScore  86.81;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GGUGAGAC (   1) MLPS  -7.88 deficit   2.09 prct   0.00 CutScore  80.23;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CCUACAAG (   1) MLPS  -7.94 deficit   2.16 prct   0.00 CutScore  79.62;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GUUAACGC (   1) MLPS  -7.98 deficit   2.20 prct   0.00 CutScore  79.26;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GGUGGCGC (   1) MLPS  -8.02 deficit   2.23 prct   0.00 CutScore  78.89;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GGUAAGAGC (   1) MLPS  -8.26 deficit   2.47 prct   0.00 CutScore  76.62;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             AGUUAUGU (   1) MLPS  -8.70 deficit   2.91 prct   0.00 CutScore  72.48;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GGUGGCUC (   1) MLPS  -8.72 deficit   2.94 prct   0.00 CutScore  72.26;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CCUGCAAG (   1) MLPS  -8.81 deficit   3.03 prct   0.00 CutScore  71.41;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GCCAUCAC (   1) MLPS -10.19 deficit   4.41 prct   0.00 CutScore  58.34;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             CUGACACG (   1) MLPS -10.78 deficit   4.99 prct   0.00 CutScore  52.82;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GAUAGUGGC (   1) MLPS -10.99 deficit   5.20 prct   0.00 CutScore  50.85;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CUCGAACAG (   1) MLPS -11.15 deficit   5.36 prct   0.00 CutScore  49.35;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CUCGAACAG (   1) MLPS -11.15 deficit   5.36 prct   0.00 CutScore  49.35;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s35-s35-s35
Group 210 is from HL_66703.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_66703.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-tSH-s35-s35-s53-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UGGCUAAAA (   1) MLPS  -6.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s35-s53-s35
Group  41 is from HL_12571.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_12571.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-s35-s55-tSH-s35-s55-cWS-s35-tSW-s35-s33-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CAAGCCUGGCCAAAG (   1) MLPS  -8.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s55-cWS-s35-tSW-s35-s33-F-F-s35
Better:   0 Equal:   0 Score 1.00      CGAGCCUGGUCAAAG (   1) MLPS  -8.65 deficit   0.02 prct   0.00 CutScore  99.89;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s55-cWS-s35-tSW-s35-s33-F-F-s35
Group 214 is from HL_67216.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_67216.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-tSH-s35-s55-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              CGGCGAG (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s55-s35-s35
Better:   0 Equal:   1 Score 0.50              CGGCGAG (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s55-s35-s35
Better:   0 Equal:   1 Score 0.50              CGGCGAG (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s55-s35-s35
Better:   0 Equal:   1 Score 0.50              CGGCGAG (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s55-s35-s35
Better:   0 Equal:   1 Score 0.50              CGGCGAG (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00              CCGCGAG (   1) MLPS  -4.66 deficit   1.44 prct   0.00 CutScore  89.72;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00              UUUCAAG (   1) MLPS  -8.67 deficit   5.45 prct   0.00 CutScore  61.04;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s35-s55-s35-s35
Group  87 is from HL_26772.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_26772.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-tSH-s55-s33-s35-F-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          AGACAUAGUUU (   1) MLPS  -9.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s55-s33-s35-F-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00         CGAAUCCAUAAG (   1) MLPS -10.85 deficit   1.12 prct   0.00 CutScore  92.98;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-s55-s33-s35-F-s35-s35-s35-s35
Group 187 is from HL_56677.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_56677.4
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-s35-s55-tSH-tWH-s35-tSH-s55-s33-s35-s55-tHW-s35-tHW-s33-tSW-s35-s35-s35-cWH-s53-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CUGAAAGCAUCUAAG (   1) MLPS  -6.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-tWH-s35-tSH-s55-s33-s35-s55-tHW-s35-tHW-s33-tSW-s35-s35-s35-cWH-s53-s35-s35
Better:   0 Equal:   0 Score 1.00      CUGAAAGCAUCUAAG (   1) MLPS  -6.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-tWH-s35-tSH-s55-s33-s35-s55-tHW-s35-tHW-s33-tSW-s35-s35-s35-cWH-s53-s35-s35
Better:   0 Equal:   0 Score 1.00      CUGAAAGCAUCUAAG (   1) MLPS  -6.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-tWH-s35-tSH-s55-s33-s35-s55-tHW-s35-tHW-s33-tSW-s35-s35-s35-cWH-s53-s35-s35
Better:   0 Equal:   0 Score 1.00      CUGAAAGCAUCUAAG (   1) MLPS  -6.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-tWH-s35-tSH-s55-s33-s35-s55-tHW-s35-tHW-s33-tSW-s35-s35-s35-cWH-s53-s35-s35
Better:   0 Equal:   0 Score 1.00      CUGAACGCAUCUAAG (   1) MLPS  -6.40 deficit   0.30 prct   0.00 CutScore  98.62;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-tWH-s35-tSH-s55-s33-s35-s55-tHW-s35-tHW-s33-tSW-s35-s35-s35-cWH-s53-s35-s35
Better:   0 Equal:   0 Score 1.00      CUGAACGCCUCUAAG (   1) MLPS  -7.71 deficit   1.61 prct   0.00 CutScore  92.52;  Ed  0, 0 matches the original group, cWW-s35-s55-tSH-tWH-s35-tSH-s55-s33-s35-s55-tHW-s35-tHW-s33-tSW-s35-s35-s35-cWH-s53-s35-s35
Group 294 is from HL_94651.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_94651.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-tSS-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CGUUCUAG (   1) MLPS  -4.42 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSS-s35-s55
Better:   0 Equal:   0 Score 1.00             CGUUCUAG (   1) MLPS  -4.42 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSS-s35-s55
Better:   0 Equal:   0 Score 1.00             CGUUUUAG (   1) MLPS  -4.42 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSS-s35-s55
Better:   0 Equal:   0 Score 1.00             CGUUUUAG (   1) MLPS  -4.42 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSS-s35-s55
Group  76 is from HL_23219.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_23219.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-tSW-cSH-s55-cWH-s35-s53-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CGUUAAUG (   1) MLPS  -4.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-cSH-s55-cWH-s35-s53-s55
Group 131 is from HL_39334.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_39334.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-tSW-s33-s35-s33-cWS-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGAUGCAAAC (   1) MLPS  -6.31 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s33-s35-s33-cWS-s35-s55
Better:   0 Equal:   0 Score 1.00           ACGUGCAAAU (   1) MLPS  -6.37 deficit   0.05 prct   0.00 CutScore  99.64;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s33-s35-s33-cWS-s35-s55
Better:   0 Equal:   0 Score 1.00           CGUUGAAAAG (   1) MLPS  -6.77 deficit   0.46 prct   0.00 CutScore  96.92;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s33-s35-s33-cWS-s35-s55
Better:   0 Equal:   0 Score 1.00           UGCUGAAACA (   1) MLPS  -7.93 deficit   1.62 prct   0.00 CutScore  89.06;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s33-s35-s33-cWS-s35-s55
Better:   0 Equal:   0 Score 1.00           UCCUACAAUA (   1) MLPS  -8.85 deficit   2.54 prct   0.00 CutScore  82.84;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s33-s35-s33-cWS-s35-s55
Group 121 is from HL_36207.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_36207.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-s55-tSW-s35-s35-s35-s33-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            CCUUUCACG (   1) MLPS  -5.99 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s35-s35-s33-s55
Group 248 is from HL_79299.9 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_79299.9
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-tSW-s35-s53-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -1.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00               GUUCGC (   1) MLPS  -2.91 deficit   1.06 prct   0.00 CutScore  89.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00               GUUCGC (   1) MLPS  -2.91 deficit   1.06 prct   0.00 CutScore  89.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00               AUUCGU (   1) MLPS  -2.97 deficit   1.12 prct   0.00 CutScore  88.94;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   1 Score 0.50               CUACGG (   1) MLPS  -3.56 deficit   1.71 prct   0.00 CutScore  83.08;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   1 Score 0.50               CUACGG (   1) MLPS  -3.56 deficit   1.71 prct   0.00 CutScore  83.08;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   1 Score 0.50               CUACGG (   1) MLPS  -3.56 deficit   1.71 prct   0.00 CutScore  83.08;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   1 Score 0.50               CUACGG (   1) MLPS  -3.56 deficit   1.71 prct   0.00 CutScore  83.08;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   1 Score 0.50               CUACGG (   1) MLPS  -3.56 deficit   1.71 prct   0.00 CutScore  83.08;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   1 Score 0.50               CUACGG (   1) MLPS  -3.56 deficit   1.71 prct   0.00 CutScore  83.08;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00               CUCCGG (   1) MLPS  -4.07 deficit   2.22 prct   0.00 CutScore  78.02;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00               AUUUGU (   1) MLPS  -5.30 deficit   3.45 prct   0.00 CutScore  65.84;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00               CGCCAG (   1) MLPS  -6.55 deficit   4.70 prct   0.00 CutScore  53.54;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00               CGCUAG (   1) MLPS  -8.88 deficit   7.03 prct   0.00 CutScore  30.44;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00               CCAAGG (   1) MLPS  -9.45 deficit   7.60 prct   0.00 CutScore  24.78;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   1 Score 0.50               CGCAAG (   1) MLPS  -9.47 deficit   7.62 prct   0.00 CutScore  24.62;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00              CUUUAAG (   1) MLPS -11.44 deficit   9.59 prct   0.00 CutScore   5.17;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Better:   0 Equal:   0 Score 1.00              GCUUGUC (   1) MLPS -12.39 deficit  10.54 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55
Group  90 is from HL_27747.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_27747.3
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-tSW-s35-s53-s55-cSH
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              UGAAAAG (   1) MLPS  -4.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55-cSH
Better:   0 Equal:   0 Score 1.00              AGAAAUU (   1) MLPS  -5.83 deficit   1.82 prct   0.00 CutScore  80.83;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s53-s55-cSH
Group  52 is from HL_16898.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_16898.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-tSW-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -5.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s55
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -5.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s55
Better:   0 Equal:   2 Score 0.33               CGUGAG (   1) MLPS  -5.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s55
Better:   0 Equal:   0 Score 1.00              UGAAAGG (   1) MLPS  -6.44 deficit   0.96 prct   0.00 CutScore  89.90;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s55
Better:   0 Equal:   0 Score 1.00              UGAAAGG (   1) MLPS  -6.44 deficit   0.96 prct   0.00 CutScore  89.90;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s55
Better:   0 Equal:   0 Score 1.00              CCAAGCG (   1) MLPS  -8.77 deficit   3.29 prct   0.00 CutScore  65.36;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s35-s55
Group 277 is from HL_90961.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_90961.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s35-s55-tSW-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CGCAUAG (   1) MLPS  -4.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s55
Group 108 is from HL_33172.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_33172.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-s55-tSW-s55-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            CCUUUCACG (   1) MLPS  -4.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s55-F
Better:   0 Equal:   1 Score 0.50            CCUUUCACG (   1) MLPS  -4.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s55-F
Group 113 is from HL_34974.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_34974.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-s55-tSW-s55-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   3 Score 0.25               CUUCGG (   1) MLPS  -3.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tSW-s55-s55
Group 101 is from HL_31286.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_31286.3
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-s55-tWH-s33-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UUUGGGGAAAG (   1) MLPS  -5.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s33-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          UUUGGGGAAAG (   1) MLPS  -5.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s33-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          UUUGGGGAAAG (   1) MLPS  -5.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s33-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          UUUGGGGAAAG (   1) MLPS  -5.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s33-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           AUUAGGUAGU (   1) MLPS  -9.37 deficit   3.60 prct   0.00 CutScore  81.91;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s33-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           AUUAAGUGGU (   1) MLPS -11.46 deficit   5.68 prct   0.00 CutScore  71.41;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s33-s35-s35-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UCUGCGAGGA (   1) MLPS -11.93 deficit   6.16 prct   0.00 CutScore  69.03;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s33-s35-s35-s35-s35-s35-s35
Group  32 is from HL_08291.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_08291.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-s55-tWH-s33-s35-s35-s35-s35-s35-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CUGACCGAUAUG (   1) MLPS  -7.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s33-s35-s35-s35-s35-s35-s35-F
Group 218 is from HL_68493.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_68493.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-tWH-s35-s55-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CUGGAAAG (   1) MLPS  -4.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             CUGGAAAG (   1) MLPS  -4.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             CUGGAAAG (   1) MLPS  -4.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             UUGGAAUA (   1) MLPS  -4.74 deficit   0.17 prct   0.00 CutScore  98.55;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             CUGGGAUG (   1) MLPS  -5.46 deficit   0.89 prct   0.00 CutScore  92.38;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             UUGGAACA (   1) MLPS  -5.84 deficit   1.27 prct   0.00 CutScore  89.11;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             CUGAGAUG (   1) MLPS  -6.34 deficit   1.77 prct   0.00 CutScore  84.75;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             UUGGGAAG (   1) MLPS  -6.75 deficit   2.18 prct   0.00 CutScore  81.27;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00             GAUGAUUC (   1) MLPS  -8.04 deficit   3.47 prct   0.00 CutScore  70.20;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Better:   0 Equal:   1 Score 0.50             GAUAAUGC (   1) MLPS -10.02 deficit   5.45 prct   0.00 CutScore  53.14;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00              CGUAAUG (   1) MLPS -10.20 deficit   5.63 prct   0.00 CutScore  51.65;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35
Group 244 is from HL_78061.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_78061.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-s55-tWH-s35-s55-s35-s35-s35-s33
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CUGCAACCCG (   1) MLPS  -4.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35-s35-s33
Better:   0 Equal:   0 Score 1.00           CUGCAACCCG (   1) MLPS  -4.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35-s35-s33
Better:   0 Equal:   0 Score 1.00           CUGCAACUCG (   1) MLPS  -5.02 deficit   0.51 prct   0.00 CutScore  97.26;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-s55-s35-s35-s35-s33
Group 144 is from HL_43613.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_43613.3
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-tWH-s35-tWH-s53-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UUUAUUAAAAA (   1) MLPS  -6.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-tWH-s53-s35
Better:   0 Equal:   0 Score 1.00          UUUAUCAAAAA (   1) MLPS  -6.96 deficit   0.45 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-tWH-s53-s35
Better:   0 Equal:   0 Score 1.00          UUUACCAAAAA (   1) MLPS  -7.42 deficit   0.90 prct   0.00 CutScore  95.20;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-tWH-s53-s35
Better:   0 Equal:   0 Score 1.00          UCUAGUAACAA (   1) MLPS  -7.98 deficit   1.46 prct   0.00 CutScore  92.23;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-tWH-s53-s35
Better:   0 Equal:   0 Score 1.00          UCUAAUUAAAA (   1) MLPS  -8.81 deficit   2.29 prct   0.00 CutScore  87.82;  Ed  0, 0 matches the original group, cWW-s35-s55-tWH-s35-tWH-s53-s35
Group 252 is from HL_80705.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_80705.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-s55-tWW-s35-s35-s53-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CUCCUCGCG (   1) MLPS  -5.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-s55-tWW-s35-s35-s53-s55
Better:   0 Equal:   1 Score 0.50           CUCCUCGCUG (   1) MLPS  -6.84 deficit   1.20 prct   0.00 CutScore  92.53;  Ed  0, 0 matches the original group, cWW-s35-s55-tWW-s35-s35-s53-s55
Group  77 is from HL_23481.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_23481.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-tSH-s33-s35-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GAAACAUC (   1) MLPS  -2.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-F-s35
Better:   0 Equal:   0 Score 1.00             GAAACAUC (   1) MLPS  -2.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-F-s35
Better:   0 Equal:   0 Score 1.00             GAAACAUC (   1) MLPS  -2.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-F-s35
Better:   0 Equal:   0 Score 1.00             GAAACAUC (   1) MLPS  -2.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-F-s35
Better:   0 Equal:   0 Score 1.00             GAAACAUC (   1) MLPS  -2.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-F-s35
Better:   0 Equal:   0 Score 1.00             UAAGCAUA (   1) MLPS  -5.25 deficit   3.16 prct   0.00 CutScore  76.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-F-s35
Better:   0 Equal:   1 Score 0.50              GGAAUAC (   1) MLPS  -9.36 deficit   7.28 prct   0.00 CutScore  44.76;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-F-s35
Group   7 is from HL_01925.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_01925.1
This group is considered to be structured ***************************
Number of NTs: 19  Signature: cWW-s35-tSH-s33-s35-s35-s35-cHW-cWH-s35-cHW-cWH-s53-s33-cWH-cHW-cWH-s35-cWH-s53-s33-cHW-cWH-tSH-s35-cWH-s53-s33-cHW-s35-s33-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CGAAGGGACGGUGCGGAGAGGAGAG (   1) MLPS -15.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-s35-s35-cHW-cWH-s35-cHW-cWH-s53-s33-cWH-cHW-cWH-s35-cWH-s53-s33-cHW-cWH-tSH-s35-cWH-s53-s33-cHW-s35-s33-s35
Group 249 is from HL_79564.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_79564.1
This group is considered to be structured ***************************
Number of NTs: 22  Signature: cWW-s35-tSH-s33-s35-s35-s35-cHW-cWH-tSH-s35-cHW-cWH-s53-s33-cWH-cHW-cWH-s35-cWH-s53-s33-cHW-cWH-tSH-s35-cWH-s53-s33-s33-cHW-s35-s33-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CGAAGGAGAGGAGAGGAAGAGGAGAG (   1) MLPS -16.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-s35-s35-cHW-cWH-tSH-s35-cHW-cWH-s53-s33-cWH-cHW-cWH-s35-cWH-s53-s33-cHW-cWH-tSH-s35-cWH-s53-s33-s33-cHW-s35-s33-s35
Group 122 is from HL_36421.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_36421.4
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-tSH-s33-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AGUUCAUAU (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            AGUCCAUAU (   1) MLPS  -3.77 deficit   0.39 prct   0.00 CutScore  97.67;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            AGUUCACAU (   1) MLPS  -3.97 deficit   0.59 prct   0.00 CutScore  96.53;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CGUUCAUAG (   1) MLPS  -4.36 deficit   0.98 prct   0.00 CutScore  94.22;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            CGUCCACAG (   1) MLPS  -5.34 deficit   1.96 prct   0.00 CutScore  88.42;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            AGCACAUAU (   1) MLPS  -5.73 deficit   2.35 prct   0.00 CutScore  86.10;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s35-s35-s35-s35
Group  56 is from HL_17956.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_17956.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-tSH-s33-s55-tHS-s33-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGAUCAAUGAG (   1) MLPS  -7.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-s55-tHS-s33-F-s35-s35
Group 232 is from HL_72419.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_72419.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-tSH-s33-tHH-s53-s35-s33-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UUCCCAACGAG (   1) MLPS  -7.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s33-tHH-s53-s35-s33-s35-s35-s35
Group 125 is from HL_37407.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_37407.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-tSH-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GAGUAUC (   1) MLPS  -4.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35
Better:   0 Equal:   0 Score 1.00              GCUUUGC (   1) MLPS  -6.30 deficit   1.33 prct   0.00 CutScore  88.90;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35
Group   8 is from HL_02361.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_02361.5
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-tSH-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CGAACAG (   1) MLPS  -5.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              CGAACAG (   1) MLPS  -5.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              UGAACAA (   1) MLPS  -5.24 deficit   0.10 prct   0.00 CutScore  98.99;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   1 Score 0.50              GGAAUAC (   1) MLPS  -5.36 deficit   0.21 prct   0.00 CutScore  97.78;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              UGAACAG (   1) MLPS  -5.56 deficit   0.42 prct   0.00 CutScore  95.60;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              UGAAUAG (   1) MLPS  -5.56 deficit   0.42 prct   0.00 CutScore  95.60;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              CGUAUAG (   1) MLPS  -6.24 deficit   1.10 prct   0.00 CutScore  88.44;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              CGUAUAG (   1) MLPS  -6.24 deficit   1.10 prct   0.00 CutScore  88.44;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              UGAAGAA (   1) MLPS  -6.54 deficit   1.40 prct   0.00 CutScore  85.31;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              CGCACAG (   1) MLPS  -6.58 deficit   1.44 prct   0.00 CutScore  84.89;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   2 Score 0.33               CGUAAG (   1) MLPS  -6.69 deficit   1.55 prct   0.00 CutScore  83.70;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              GGAGUAC (   1) MLPS  -6.72 deficit   1.57 prct   0.00 CutScore  83.44;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              AGAGAAU (   1) MLPS  -7.57 deficit   2.43 prct   0.00 CutScore  74.45;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UGCAUA (   1) MLPS  -7.91 deficit   2.76 prct   0.00 CutScore  70.91;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00              UCAGAAG (   1) MLPS  -8.47 deficit   3.33 prct   0.00 CutScore  64.96;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00               UUGCAG (   1) MLPS -10.99 deficit   5.84 prct   0.00 CutScore  38.48;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s35-s35
Group  64 is from HL_19398.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_19398.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-tSH-s35-s55-cWS-s35-cSH-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50          CAAGCGGUAAG (   1) MLPS  -8.47 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s55-cWS-s35-cSH-s35
Better:   0 Equal:   1 Score 0.50          CAAGCGGUAAG (   1) MLPS  -8.47 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s55-cWS-s35-cSH-s35
Group  25 is from HL_06569.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_06569.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-tSH-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               AGAAUU (   1) MLPS  -5.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s55-s35
Better:   0 Equal:   1 Score 0.50               AGAAAU (   1) MLPS  -6.07 deficit   0.51 prct   0.00 CutScore  94.62;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s55-s35
Better:   0 Equal:   0 Score 1.00                CGUAG (   1) MLPS  -6.44 deficit   0.88 prct   0.00 CutScore  90.70;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s55-s35
Better:   0 Equal:   0 Score 1.00              CACAUUG (   1) MLPS  -9.04 deficit   3.48 prct   0.00 CutScore  63.33;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s55-s35
Group  40 is from HL_12053.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_12053.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-tSH-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CGCAACG (   1) MLPS  -5.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-s55-s35
Group 207 is from HL_63285.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_63285.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-tSH-s35-tSH-s35-s35-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50             GUUAAAAC (   1) MLPS  -4.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s35-tSH-s35-s35-F-s35
Group 161 is from HL_49213.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_49213.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-tSH-s55-s33-tHW-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGAAAUGAAC (   1) MLPS  -6.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s55-s33-tHW-s35-s35-s35-s35
Group 266 is from HL_86843.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_86843.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-tSH-s55-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          AAAGCGGUUAU (   1) MLPS  -9.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00          CUAGGGGCUAG (   1) MLPS  -9.50 deficit   0.49 prct   0.00 CutScore  97.07;  Ed  0, 0 matches the original group, cWW-s35-tSH-s55-s35-s35-s35
Group 255 is from HL_81820.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_81820.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-s35-tSH-s55-tHW-s35-tHW-s33-s35-cSH-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGAAUCCAUAG (   1) MLPS  -7.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSH-s55-tHW-s35-tHW-s33-s35-cSH-s35-s35-s35-s35-s35
Group   6 is from HL_01472.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_01472.3
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s35-tSW-F-s55-s53
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GUUCGGC (   1) MLPS  -4.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSW-F-s55-s53
Better:   0 Equal:   0 Score 1.00              GUCCGGC (   1) MLPS  -4.67 deficit   0.51 prct   0.00 CutScore  95.95;  Ed  0, 0 matches the original group, cWW-s35-tSW-F-s55-s53
Better:   0 Equal:   0 Score 1.00              CUUCGCG (   1) MLPS  -4.73 deficit   0.56 prct   0.00 CutScore  95.53;  Ed  0, 0 matches the original group, cWW-s35-tSW-F-s55-s53
Group 226 is from HL_69818.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_69818.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s35-tSW-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               UGUAAG (   1) MLPS  -4.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tSW-s35-s55
Group  31 is from HL_08002.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_08002.5
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-tWH-F-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GUAUAGUC (   1) MLPS  -3.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00             GUAUAGUC (   1) MLPS  -3.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00             GUAUAGUC (   1) MLPS  -3.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00             GUAGAGUC (   1) MLPS  -4.03 deficit   0.17 prct   0.00 CutScore  98.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00             GUAGAGUC (   1) MLPS  -4.03 deficit   0.17 prct   0.00 CutScore  98.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00             GUAGAGUC (   1) MLPS  -4.03 deficit   0.17 prct   0.00 CutScore  98.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   1 Score 0.50            GUGAGAGUC (   1) MLPS  -4.35 deficit   0.48 prct   0.00 CutScore  96.59;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   1 Score 0.50            GUGAGAAUC (   1) MLPS  -5.34 deficit   1.48 prct   0.00 CutScore  89.49;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUAUACUC (   1) MLPS  -6.30 deficit   2.44 prct   0.00 CutScore  82.67;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUAUACUC (   1) MLPS  -6.30 deficit   2.44 prct   0.00 CutScore  82.67;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGACAGCC (   1) MLPS  -6.32 deficit   2.46 prct   0.00 CutScore  82.52;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00            GUAAUAAUC (   1) MLPS  -6.48 deficit   2.61 prct   0.00 CutScore  81.43;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAAAGCC (   1) MLPS  -6.84 deficit   2.97 prct   0.00 CutScore  78.88;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGACAACC (   1) MLPS  -7.32 deficit   3.46 prct   0.00 CutScore  75.41;  Ed  0, 0 matches the original group, cWW-s35-tWH-F-F-s35-s35
Group   4 is from HL_01181.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_01181.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-tWH-s33-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GCACCGUC (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s33-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00             GCACCGUC (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s33-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUCAUCAGC (   1) MLPS  -8.48 deficit   2.14 prct   0.00 CutScore  85.26;  Ed  0, 0 matches the original group, cWW-s35-tWH-s33-s35-s35-s35-s35
Group  78 is from HL_23537.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_23537.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s35-tWH-s35-s35-s33-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GUCCCAAGCC (   1) MLPS  -3.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s35-s33-s35-s35
Better:   0 Equal:   0 Score 1.00           GUCCCAAGCC (   1) MLPS  -3.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s35-s33-s35-s35
Better:   0 Equal:   0 Score 1.00           GUCCUAAGCC (   1) MLPS  -4.31 deficit   0.51 prct   0.00 CutScore  97.36;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s35-s33-s35-s35
Group 276 is from HL_90642.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_90642.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-tWH-s35-s55-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GUGAAGAUGC (   1) MLPS  -5.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00           GUGAAGAUGC (   1) MLPS  -5.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00           GUAAAGAUGC (   1) MLPS  -6.79 deficit   1.34 prct   0.00 CutScore  92.07;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00           GGGAACGGGC (   1) MLPS  -7.66 deficit   2.21 prct   0.00 CutScore  86.88;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35
Better:   0 Equal:   0 Score 1.00           GUGCGGAGUC (   1) MLPS  -8.55 deficit   3.09 prct   0.00 CutScore  81.62;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35
Group 109 is from HL_33239.14 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_33239.14
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s35-tWH-s35-s55-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAAUC (   1) MLPS  -2.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAUUC (   1) MLPS  -3.15 deficit   0.34 prct   0.00 CutScore  97.60;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAAUC (   1) MLPS  -3.26 deficit   0.45 prct   0.00 CutScore  96.81;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGUC (   1) MLPS  -3.39 deficit   0.58 prct   0.00 CutScore  95.87;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGUC (   1) MLPS  -3.39 deficit   0.58 prct   0.00 CutScore  95.87;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGUC (   1) MLPS  -3.39 deficit   0.58 prct   0.00 CutScore  95.87;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGUC (   1) MLPS  -3.39 deficit   0.58 prct   0.00 CutScore  95.87;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGUC (   1) MLPS  -3.39 deficit   0.58 prct   0.00 CutScore  95.87;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGUC (   1) MLPS  -3.39 deficit   0.58 prct   0.00 CutScore  95.87;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGUC (   1) MLPS  -3.39 deficit   0.58 prct   0.00 CutScore  95.87;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGUC (   1) MLPS  -3.39 deficit   0.58 prct   0.00 CutScore  95.87;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAUUC (   1) MLPS  -3.59 deficit   0.78 prct   0.00 CutScore  94.41;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAUUC (   1) MLPS  -3.59 deficit   0.78 prct   0.00 CutScore  94.41;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAUUC (   1) MLPS  -3.59 deficit   0.78 prct   0.00 CutScore  94.41;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAUUC (   1) MLPS  -3.59 deficit   0.78 prct   0.00 CutScore  94.41;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAGUC (   1) MLPS  -3.84 deficit   1.03 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAGUC (   1) MLPS  -3.84 deficit   1.03 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAGUC (   1) MLPS  -3.84 deficit   1.03 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAGUC (   1) MLPS  -3.84 deficit   1.03 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAGUC (   1) MLPS  -3.84 deficit   1.03 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAGUC (   1) MLPS  -3.84 deficit   1.03 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAGUC (   1) MLPS  -3.84 deficit   1.03 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAGUC (   1) MLPS  -3.84 deficit   1.03 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAGUC (   1) MLPS  -3.84 deficit   1.03 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCAAGUC (   1) MLPS  -3.84 deficit   1.03 prct   0.00 CutScore  92.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUAGAUUC (   1) MLPS  -4.54 deficit   1.73 prct   0.00 CutScore  87.68;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGACUC (   1) MLPS  -4.75 deficit   1.95 prct   0.00 CutScore  86.13;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGACUC (   1) MLPS  -4.75 deficit   1.95 prct   0.00 CutScore  86.13;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGACUC (   1) MLPS  -4.75 deficit   1.95 prct   0.00 CutScore  86.13;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGCAAGUC (   1) MLPS  -5.03 deficit   2.22 prct   0.00 CutScore  84.14;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGCAAGUC (   1) MLPS  -5.03 deficit   2.22 prct   0.00 CutScore  84.14;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAUCC (   1) MLPS  -5.36 deficit   2.55 prct   0.00 CutScore  81.83;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAUCC (   1) MLPS  -5.36 deficit   2.55 prct   0.00 CutScore  81.83;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAUCC (   1) MLPS  -5.36 deficit   2.55 prct   0.00 CutScore  81.83;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAUCC (   1) MLPS  -5.36 deficit   2.55 prct   0.00 CutScore  81.83;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUUCGAUCC (   1) MLPS  -5.36 deficit   2.55 prct   0.00 CutScore  81.83;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUGAGAAUC (   1) MLPS  -5.40 deficit   2.59 prct   0.00 CutScore  81.54;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUGAGAAUC (   1) MLPS  -5.40 deficit   2.59 prct   0.00 CutScore  81.54;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUGAGAAUC (   1) MLPS  -5.40 deficit   2.59 prct   0.00 CutScore  81.54;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUGAGAAUC (   1) MLPS  -5.40 deficit   2.59 prct   0.00 CutScore  81.54;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUGAGAAUC (   1) MLPS  -5.40 deficit   2.59 prct   0.00 CutScore  81.54;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUGAGAAUC (   1) MLPS  -5.40 deficit   2.59 prct   0.00 CutScore  81.54;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUGAGAAUC (   1) MLPS  -5.40 deficit   2.59 prct   0.00 CutScore  81.54;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGCC (   1) MLPS  -5.60 deficit   2.79 prct   0.00 CutScore  80.10;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGCC (   1) MLPS  -5.60 deficit   2.79 prct   0.00 CutScore  80.10;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   1 Score 0.50            GUGAGAGUC (   1) MLPS  -5.98 deficit   3.17 prct   0.00 CutScore  77.41;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAAAUUC (   1) MLPS  -6.18 deficit   3.37 prct   0.00 CutScore  75.95;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAAAUUC (   1) MLPS  -6.18 deficit   3.37 prct   0.00 CutScore  75.95;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAAAUUC (   1) MLPS  -6.18 deficit   3.37 prct   0.00 CutScore  75.95;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAAAUUC (   1) MLPS  -6.18 deficit   3.37 prct   0.00 CutScore  75.95;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAAAUUC (   1) MLPS  -6.18 deficit   3.37 prct   0.00 CutScore  75.95;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAAAUUC (   1) MLPS  -6.18 deficit   3.37 prct   0.00 CutScore  75.95;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAAAUUC (   1) MLPS  -6.18 deficit   3.37 prct   0.00 CutScore  75.95;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGCAACUC (   1) MLPS  -6.40 deficit   3.59 prct   0.00 CutScore  74.40;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGCAACUC (   1) MLPS  -6.40 deficit   3.59 prct   0.00 CutScore  74.40;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUCGAGAC (   1) MLPS  -7.18 deficit   4.37 prct   0.00 CutScore  68.83;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGCAAGCC (   1) MLPS  -7.25 deficit   4.44 prct   0.00 CutScore  68.37;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGUAAUUC (   1) MLPS  -7.33 deficit   4.52 prct   0.00 CutScore  67.76;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAGAACC (   1) MLPS  -7.61 deficit   4.80 prct   0.00 CutScore  65.76;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAAACUC (   1) MLPS  -7.79 deficit   4.98 prct   0.00 CutScore  64.47;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUGAAAAGC (   1) MLPS  -8.97 deficit   6.16 prct   0.00 CutScore  56.12;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            AUGAGAACU (   1) MLPS -10.39 deficit   7.58 prct   0.00 CutScore  45.96;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UUUUGUAUAA (   1) MLPS -14.81 deficit  12.00 prct   0.00 CutScore  14.44;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UUUUGUAGAA (   1) MLPS -17.93 deficit  15.12 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UAUUGAAGCA (   1) MLPS -18.14 deficit  15.33 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UAUUGAAGCA (   1) MLPS -18.14 deficit  15.33 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           UCUUGAAACA (   1) MLPS -18.42 deficit  15.61 prct   0.00 CutScore  -0.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-s55-s35-s35-s35
Group 238 is from HL_73793.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_73793.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-tWH-s35-tWH-s33-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GAUAGAAGC (   1) MLPS  -6.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-tWH-s33-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GAUAAAAGC (   1) MLPS  -6.61 deficit   0.51 prct   0.00 CutScore  96.18;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-tWH-s33-s35-s35-s35-s35
Better:   0 Equal:   1 Score 0.50             GGUUGGCC (   1) MLPS -10.68 deficit   4.59 prct   0.00 CutScore  65.71;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-tWH-s33-s35-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUAUCUUU (   1) MLPS -11.21 deficit   5.11 prct   0.00 CutScore  61.78;  Ed  0, 0 matches the original group, cWW-s35-tWH-s35-tWH-s33-s35-s35-s35-s35
Group 229 is from HL_70682.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_70682.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-tWH-s53-s33-s35-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GUCAAGAUUC (   1) MLPS  -5.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s53-s33-s35-s55-s35
Group 245 is from HL_78457.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_78457.3
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s35-tWH-s55-tSH-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GUUAAUAUUC (   1) MLPS  -4.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           GUUAAUAUUC (   1) MLPS  -4.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           GUUAAUAUUC (   1) MLPS  -4.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWH-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           GUUAAGAUUC (   1) MLPS  -5.60 deficit   1.10 prct   0.00 CutScore  93.30;  Ed  0, 0 matches the original group, cWW-s35-tWH-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00           GUUGAUAUUC (   1) MLPS  -5.80 deficit   1.30 prct   0.00 CutScore  92.08;  Ed  0, 0 matches the original group, cWW-s35-tWH-s55-tSH-s35-s35-s35
Better:   0 Equal:   0 Score 1.00            GUUACAAUC (   1) MLPS  -7.17 deficit   2.67 prct   0.00 CutScore  83.72;  Ed  0, 0 matches the original group, cWW-s35-tWH-s55-tSH-s35-s35-s35
Group 127 is from HL_37846.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_37846.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s35-tWW-s35-s35-s53-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50           CUCCUCGCUG (   1) MLPS  -7.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s35-tWW-s35-s35-s53-s55
Group 156 is from HL_48636.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_48636.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s53-F-cWH-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UGUGAGAGG (   1) MLPS  -6.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s53-F-cWH-s55
Group 129 is from HL_38513.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_38513.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s53-F-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50           UCAAGCCUAG (   1) MLPS  -6.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s53-F-s35-s35-s35-s35-s35
Group 251 is from HL_80171.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_80171.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s53-s35-s35-s33
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33                GUCUC (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s53-s35-s35-s33
Group 246 is from HL_78724.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_78724.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s53-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AAAAUCACU (   1) MLPS  -6.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s53-s35-s35-s35
Group 120 is from HL_36095.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_36095.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-s53-s55-s33-F-F-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UUGAUAUGAUG (   1) MLPS  -7.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s53-s55-s33-F-F-s55
Group 192 is from HL_58539.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_58539.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-s53-s55-tWS-tHW-F-F-s55-s33-s35-s35-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     UUAAAUUGGGCACUUG (   1) MLPS  -9.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s53-s55-tWS-tHW-F-F-s55-s33-s35-s35-s35-s35-s35-s35
Group  20 is from HL_05667.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_05667.1
This group is considered to be structured ***************************
Number of NTs:  3  Signature: cWW-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50                GGUAC (   1) MLPS  -4.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55
Group 178 is from HL_53499.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_53499.1
This group is considered to be structured ***************************
Number of NTs:  4  Signature: cWW-s55-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CAGCUGGGAG (   1) MLPS  -8.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-F
Group  61 is from HL_18808.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_18808.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s55-cWS-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CAAUUGGAUAG (   1) MLPS -10.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35
Group 254 is from HL_81327.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_81327.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s55-cWS-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33            CAGUGGUAG (   1) MLPS  -7.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35
Better:   0 Equal:   0 Score 1.00          CAGUUGGUUAG (   1) MLPS  -9.39 deficit   1.64 prct   0.00 CutScore  89.41;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35
Better:   0 Equal:   0 Score 1.00           CAGCCGGUAG (   1) MLPS -10.76 deficit   3.00 prct   0.00 CutScore  80.59;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35
Group 171 is from HL_51090.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_51090.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s55-cWS-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CAGCUGGUCAG (   1) MLPS -10.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F
Group 203 is from HL_61092.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_61092.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s55-cWS-s35-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33            CAGUGGUAG (   1) MLPS  -6.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-F
Better:   0 Equal:   0 Score 1.00            CAAUGGUAG (   1) MLPS  -6.61 deficit   0.45 prct   0.00 CutScore  97.25;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-F
Better:   0 Equal:   0 Score 1.00            CAAUGGUAG (   1) MLPS  -6.61 deficit   0.45 prct   0.00 CutScore  97.25;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-F
Better:   0 Equal:   0 Score 1.00            CAAUGGUAG (   1) MLPS  -6.61 deficit   0.45 prct   0.00 CutScore  97.25;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-F
Better:   0 Equal:   0 Score 1.00           CAGUUGGGAG (   1) MLPS  -7.86 deficit   1.70 prct   0.00 CutScore  89.69;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-F
Better:   0 Equal:   0 Score 1.00           CAGUUGGGAG (   1) MLPS  -7.86 deficit   1.70 prct   0.00 CutScore  89.69;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-F
Better:   0 Equal:   3 Score 0.25           CAGUCGGUAG (   1) MLPS  -8.34 deficit   2.17 prct   0.00 CutScore  86.77;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-F
Better:   0 Equal:   3 Score 0.25           CAGUCGGUAG (   1) MLPS  -8.34 deficit   2.17 prct   0.00 CutScore  86.77;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-F
Group  38 is from HL_10751.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_10751.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s55-cWS-s35-F-s33
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33          CAGCCUGGUAG (   1) MLPS  -5.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-s33
Better:   0 Equal:   2 Score 0.33          CAGCCUGGUAG (   1) MLPS  -5.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-s33
Better:   0 Equal:   2 Score 0.33          CAGCCUGGUAG (   1) MLPS  -5.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-s33
Better:   0 Equal:   2 Score 0.33          CAGCCUGGUAG (   1) MLPS  -5.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-s33
Better:   0 Equal:   2 Score 0.33          CAGCCUGGUAG (   1) MLPS  -5.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-s33
Better:   0 Equal:   0 Score 1.00          CAGCCCGGUAG (   1) MLPS  -7.27 deficit   1.30 prct   0.00 CutScore  93.50;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-s33
Better:   0 Equal:   0 Score 1.00         UAGCCAGGACAG (   1) MLPS -14.38 deficit   8.40 prct   0.00 CutScore  57.98;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-F-s33
Group 301 is from HL_97049.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_97049.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s55-cWS-s35-cSH
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   3 Score 0.25           CAGUCGGUAG (   1) MLPS  -9.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-cSH
Group 269 is from HL_88225.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_88225.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s55-cWS-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33            CAGUGGUAG (   1) MLPS  -7.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s35
Better:   0 Equal:   0 Score 1.00            CAGGGGUAG (   1) MLPS  -8.15 deficit   0.85 prct   0.00 CutScore  94.34;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s35
Better:   0 Equal:   0 Score 1.00            CAGCGGAAG (   1) MLPS  -8.59 deficit   1.29 prct   0.00 CutScore  91.37;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s35
Better:   0 Equal:   0 Score 1.00           CAGUUGGUAG (   1) MLPS  -9.05 deficit   1.75 prct   0.00 CutScore  88.34;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s35
Better:   0 Equal:   3 Score 0.25           CAGUCGGUAG (   1) MLPS  -9.67 deficit   2.36 prct   0.00 CutScore  84.21;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s35
Better:   0 Equal:   0 Score 1.00         UAGCCAGGUCAG (   1) MLPS -15.95 deficit   8.65 prct   0.00 CutScore  42.28;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s35
Group 135 is from HL_41778.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_41778.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s55-cWS-s35-s35-tSW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UAGAGGCCCAG (   1) MLPS  -7.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s35-tSW
Better:   0 Equal:   0 Score 1.00          UAGAGGCCCAG (   1) MLPS  -7.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s35-tSW
Better:   0 Equal:   0 Score 1.00          UAGAGGCCCAG (   1) MLPS  -7.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s35-tSW
Better:   0 Equal:   0 Score 1.00           UAGCGGUUAG (   1) MLPS -10.94 deficit   3.06 prct   0.00 CutScore  84.46;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s35-tSW
Group 183 is from HL_55511.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_55511.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s55-cWS-s35-s53
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UAACGGUAG (   1) MLPS  -8.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s53
Better:   0 Equal:   1 Score 0.50          CAGGCGGUUAG (   1) MLPS -11.30 deficit   2.34 prct   0.00 CutScore  84.30;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s53
Group  89 is from HL_27359.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_27359.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s55-cWS-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UAGGGGCUA (   1) MLPS  -7.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s55
Better:   0 Equal:   2 Score 0.33          CAGCCUGGUAG (   1) MLPS -11.51 deficit   3.90 prct   0.00 CutScore  76.42;  Ed  0, 0 matches the original group, cWW-s55-cWS-s35-s55
Group 184 is from HL_56089.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_56089.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s55-cWW-s35-F-F-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CCGAAUAG (   1) MLPS  -5.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-cWW-s35-F-F-s35
Group 193 is from HL_58733.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_58733.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-s55-s33-s35-s55-s35-F-F-F-F-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CGGAGCGGCUGAAG (   1) MLPS -10.52 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-s33-s35-s55-s35-F-F-F-F-s35-s35
Group 273 is from HL_90197.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_90197.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-s55-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               UGUAGG (   1) MLPS  -3.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-s35
Group  63 is from HL_19239.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_19239.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s55-s35-F-F-F-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33          CAGCCUGGUAG (   1) MLPS  -8.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-s35-F-F-F-F
Group 115 is from HL_35188.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_35188.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s55-s35-s33-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CAGCCUGGGAG (   1) MLPS  -6.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-s35-s33-F
Group 157 is from HL_48810.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_48810.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s55-s35-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CAGCGGGAG (   1) MLPS  -7.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-s35-s35-F
Better:   0 Equal:   0 Score 1.00          CAGCUGGUUAG (   1) MLPS  -8.04 deficit   0.71 prct   0.00 CutScore  95.50;  Ed  0, 0 matches the original group, cWW-s55-s35-s35-F
Better:   0 Equal:   0 Score 1.00          CAGCUGGUUAG (   1) MLPS  -8.04 deficit   0.71 prct   0.00 CutScore  95.50;  Ed  0, 0 matches the original group, cWW-s55-s35-s35-F
Group 175 is from HL_52853.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_52853.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-s55-s35-s35-F
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50          CAGGCGGUUAG (   1) MLPS -10.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-s35-s35-F
Group  13 is from HL_03427.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_03427.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-s55-s35-s35-s33
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UCUCAUAAG (   1) MLPS  -5.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-s35-s35-s33
Group 257 is from HL_82782.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_82782.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-s55-s35-tSH-s33-s55-tHS-s33-F-s55-F-s35-s35-F-s35-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  CUGACCGAAAGGCGUGAUG (   1) MLPS -14.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-s35-tSH-s33-s55-tHS-s33-F-s55-F-s35-s35-F-s35-s35-s35-s35
Group 304 is from HL_98252.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_98252.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s55-s55-tWW-s35-s53-s35-s55-s53
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          AUUAUUUAUUU (   1) MLPS  -7.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-s55-tWW-s35-s53-s35-s55-s53
Group   9 is from HL_02483.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_02483.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-s55-tWH-cSH-s33-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UGAUCACGAAGG (   1) MLPS  -7.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-tWH-cSH-s33-s35-s35-s35
Group 231 is from HL_72066.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_72066.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-s55-tWH-s33-F-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UGUUCAAAG (   1) MLPS  -4.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-s55-tWH-s33-F-s35-s35-s35
Group  69 is from HL_20751.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_20751.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tHW-F-s35-s35-s35-s35-s35-s35-s35-s55
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CAGGGGAGGAAUCG (   1) MLPS  -7.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHW-F-s35-s35-s35-s35-s35-s35-s35-s55
Better:   0 Equal:   0 Score 1.00       CAGGGGAGGAAUCG (   1) MLPS  -7.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHW-F-s35-s35-s35-s35-s35-s35-s35-s55
Group  45 is from HL_12870.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/HL_12870.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tHW-F-s35-s35-s35-s35-s35-s53-s35-s35-s35
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GUCCUUGGGAAAC (   1) MLPS  -6.91 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHW-F-s35-s35-s35-s35-s35-s53-s35-s35-s35
